Rh6CG019300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0000427
Physical Location & Seq
Reverse (-)
1874192 .. 1874479
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG019300.1

Sequence Viewer

Length: 288 bp
ATGGCCAGAACTCCATTGATCAGCTCAAATTCTTGGGTTGTTGGTCACTGGCAGTCTGGCACTCCAAAATCATTACTGCCATTATCATCCATGGCTAACTATCTTATTCTCTCGTTTTTGCTTCTAATTTGCATTCTATCATATGGCTCAGAAACACTCACAGCCAAAAGGCCCAAAATCACAATTGAAGAAGCTACTGTTGATGATCTCCAGCTTGCTTTCAAGCTCAACACTGCAACTTGTTCTGTTCTACATGGACAAGATTTAAAAACTGAACAAAAACCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.45

Weight (kDa)

7.8

Isoelectric Point (pI)

39.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000427)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G34880 AT4G34880
fragaria_vesca FvH4_2g01710 FvH4_2g01720 FvH4_2g01722
malus_domestica MD05G1117000.v1.1 MD05G1117200.v1.1 MD10G1120200.v1.1 MD10G1120300.v1.1 MD10G1120400.v1.1
prunus_persica Prupe.8G161600_v2.0.a1 Prupe.8G161700_v2.0.a1 Prupe.8G161700_v2.0.a1 Prupe.8G161800_v2.0.a1 Prupe.8G161900_v2.0.a1
pyrus_communis pycom05g06760 pycom10g10360 pycom10g10370 pycom17g11700
rosa_chinensis RchiOBHm_Chr6g0244611 RchiOBHm_Chr6g0244621 RchiOBHm_Chr6g0244631 RchiOBHm_Chr6g0244671 RchiOBHm_Chr6g0244701 RchiOBHm_Chr6g0244721 RchiOBHm_Chr6g0244741 RchiOBHm_Chr6g0244751
rosa_laevigata RLG00000015331 RLG00000015332 RLG00000015333 RLG00000015334 RLG00000015336 RLG00000015338 RLG00000015339 RLG00000015340
rosa_multiflora Rmu_co8154324.1_g000001 Rmu_co8259027.1_g000001 Rmu_co8319583.1_g000001 Rmu_sc0002064.1_g000004 Rmu_sc0002522.1_g000021 Rmu_sc0002522.1_g000022 Rmu_sc0002522.1_g000023 Rmu_sc0002522.1_g000026 Rmu_sc0002522.1_g000027 Rmu_sc0006257.1_g000002 Rmu_sc0006635.1_g000001 Rmu_sc0006635.1_g000002 Rmu_sc0007349.1_g000001 Rmu_sc0011292.1_g000009 Rmu_sc0011292.1_g000010 Rmu_sc0039466.1_g000001
rosa_roxburghii Rroxscaffold_7G00215530 Rroxscaffold_7G00215550 Rroxscaffold_7G00215560 Rroxscaffold_7G00215570 Rroxscaffold_7G00215610 Rroxscaffold_7G00215620 Rroxscaffold_7G00215630 Rroxscaffold_7G00215640
rosa_rugosa Rorug05G0509900 Rorug05G0510000 Rorug05G0510000 Rorug05G0510100 Rorug05G0510100 Rorug05G0510200 Rorug05G0510300 Rorug05G0510400
rosa_samantha Rh6BG020500 Rh6BG020600 Rh6BG020700 Rh6BG020900 Rh6BG021000 Rh6BG021100 Rh6BG021200 Rh6CG018800 Rh6CG019000 Rh6CG019100 Rh6CG019200 Rh6CG019300 Rh6CG019400 Rh6CG019600 Rh6CG019800 Rh6DG019900 Rh6DG020100 Rh6DG020200 Rh6DG020400
rosa_wichuraiana Rw0G014670 Rw6G000010 Rw6G000020 Rw6G002100 Rw6G002110 Rw6G002120 Rw6G002140 Rw6G002150 Rw6G002160 Rw6G005110

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 28
AgsI TTSAA 2 cut(s) 188, 223
AluBI AGCT 4 cut(s) 24, 194, 214, 226
AluI AGCT 4 cut(s) 24, 194, 214, 226
AoxI GGCC 2 cut(s) 3, 170
ApoI RAATTY 1 cut(s) 28
AspS9I GGNCC 1 cut(s) 171
BalI TGGCCA 1 cut(s) 5
BclI TGATCA 1 cut(s) 18
BmgT120I GGNCC 1 cut(s) 171
BpmI CTGGAG 1 cut(s) 194
BsaJI CCNNGG 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 53
BseDI CCNNGG 1 cut(s) 90
BseGI GGATG 1 cut(s) 86
BseMII CTCAG 1 cut(s) 162
BseNI ACTGG 1 cut(s) 53
BshFI GGCC 2 cut(s) 5, 172
BsmI GAATGC 1 cut(s) 132
BsnI GGCC 2 cut(s) 5, 172
Bsp143I GATC 2 cut(s) 18, 205
Bsp19I CCATGG 1 cut(s) 90
BspANI GGCC 2 cut(s) 5, 172
BspCNI CTCAG 1 cut(s) 161
BsrI ACTGG 1 cut(s) 53
BssECI CCNNGG 1 cut(s) 90
BssMI GATC 2 cut(s) 18, 205
BssT1I CCWWGG 1 cut(s) 90
Bst4CI ACNGT 1 cut(s) 199
BstC8I GCNNGC 1 cut(s) 216
BstDEI CTNAG 2 cut(s) 148, 285
BstDSI CCRYGG 1 cut(s) 90
BstF5I GGATG 1 cut(s) 86
BstKTI GATC 2 cut(s) 21, 208
BstMBI GATC 2 cut(s) 18, 205
BsuRI GGCC 2 cut(s) 5, 172
BtgI CCRYGG 1 cut(s) 90
BtsCI GGATG 1 cut(s) 86
BtsI GCAGTG 1 cut(s) 231
BtsIMutI CAGTG 2 cut(s) 46, 231
Cac8I GCNNGC 1 cut(s) 216
Cfr13I GGNCC 1 cut(s) 171
CviAII CATG 2 cut(s) 91, 254
CviJI RGCY 9 cut(s) 5, 24, 95, 147, 164, 172, 194, 214, 226
CviKI_1 RGCY 9 cut(s) 5, 24, 95, 147, 164, 172, 194, 214, 226
DdeI CTNAG 2 cut(s) 148, 285
DpnI GATC 2 cut(s) 20, 207
DpnII GATC 2 cut(s) 18, 205
DraI TTTAAA 1 cut(s) 267
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 90
EcoT14I CCWWGG 1 cut(s) 90
ErhI CCWWGG 1 cut(s) 90
FaeI CATG 2 cut(s) 94, 257
FaiI YATR 4 cut(s) 92, 142, 144, 255
FatI CATG 2 cut(s) 90, 253
FauNDI CATATG 1 cut(s) 142
FbaI TGATCA 1 cut(s) 18
FokI GGATG 1 cut(s) 73
GsuI CTGGAG 1 cut(s) 194
HaeIII GGCC 2 cut(s) 5, 172
Hin1II CATG 2 cut(s) 94, 257
Hpy188I TCNGA 1 cut(s) 151
HpyCH4III ACNGT 1 cut(s) 199
HpyCH4V TGCA 2 cut(s) 132, 236
HpyF3I CTNAG 2 cut(s) 148, 285
Hsp92II CATG 2 cut(s) 94, 257
Ksp22I TGATCA 1 cut(s) 18
Kzo9I GATC 2 cut(s) 18, 205
LpnPI CCDG 4 cut(s) 19, 34, 42, 224
MaeIII GTNAC 1 cut(s) 44
MalI GATC 2 cut(s) 20, 207
MboI GATC 2 cut(s) 18, 205
MboII GAAGA 1 cut(s) 200
MfeI CAATTG 1 cut(s) 183
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 28, 126, 183
MluNI TGGCCA 1 cut(s) 5
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 266
Msp20I TGGCCA 1 cut(s) 5
MunI CAATTG 1 cut(s) 183
Mva1269I GAATGC 1 cut(s) 132
NcoI CCATGG 1 cut(s) 90
NdeI CATATG 1 cut(s) 142
NdeII GATC 2 cut(s) 18, 205
NlaIII CATG 2 cut(s) 94, 257
NmuCI GTSAC 1 cut(s) 44
PctI GAATGC 1 cut(s) 132
PspPI GGNCC 1 cut(s) 171
SaqAI TTAA 1 cut(s) 266
Sau3AI GATC 2 cut(s) 18, 205
Sau96I GGNCC 1 cut(s) 171
SetI ASST 5 cut(s) 26, 196, 216, 228, 286
Sse9I AATT 3 cut(s) 28, 126, 183
StyI CCWWGG 1 cut(s) 90
TaaI ACNGT 1 cut(s) 199
TasI AATT 3 cut(s) 28, 126, 183
Tru1I TTAA 1 cut(s) 266
Tru9I TTAA 1 cut(s) 266
TscAI CASTG 2 cut(s) 53, 238
TseFI GTSAC 1 cut(s) 44
Tsp45I GTSAC 1 cut(s) 44
TspRI CASTG 2 cut(s) 53, 238
XapI RAATTY 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.