Rmu_sc0010356.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010356.1
Physical Location & Seq
Reverse (-)
1 .. 1614
1614 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010356.1_g000001.1.cds

Sequence Viewer

Length: 350 bp
atgatctcctacagcaattcactttatattgaattatgtgtttatgggttagtttgttttaggaatttgtccagcttgaatcttggcgaagagatttcgccagcccttggagatctgggaaacttggaatccatgaatttatctgacaataatccgtctggtgacataccattctcggtttcaaagcttaagaaccttgaggttttgaatttgaagaacaatcagttgactggtcctatcgctacaactcttacccaaattccaaaccttagaactcttgatctttctcggaaccagctcactggtgagacaccaaggctaatatcttggaataaagttttgcagtacct
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

12.96

Weight (kDa)

4.93

Isoelectric Point (pI)

29.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000383)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G07180 AT5G07180 AT5G62230 AT5G62230
fragaria_vesca FvH4_7g28290 FvH4_7g28290 FvH4_7g28290 FvH4_7g28290
malus_domestica MD02G1216900.v1.1 MD07G1259500.v1.1 MD17G1114200.v1.1 MD17G1114300.v1.1
prunus_persica Prupe.2G283600_v2.0.a1
pyrus_communis pycom05g04060 pycom07g23280 pycom15g04040
rosa_chinensis RchiOBHm_Chr1g0375261 RchiOBHm_Chr2g0167851 RchiOBHm_Chr4g0390421 RchiOBHm_Chr4g0390431 RchiOBHm_Chr4g0442901 RchiOBHm_Chr4g0442981 RchiOBHm_Chr7g0228991 RchiOBHm_Chr7g0239711
rosa_laevigata RLG00000005460 RLG00000005968 RLG00000005971 RLG00000005973 RLG00000005978 RLG00000008547 RLG00000010012 RLG00000010245 RLG00000026673 RLG00000030046 RLG00000031637
rosa_multiflora Rmu_co8166860.1_g000001 Rmu_co8410161.1_g000001 Rmu_sc0000554.1_g000034 Rmu_sc0001782.1_g000050 Rmu_sc0002096.1_g000036 Rmu_sc0003006.1_g000022 Rmu_sc0003701.1_g000003 Rmu_sc0005877.1_g000004 Rmu_sc0006329.1_g000003 Rmu_sc0006695.1_g000032 Rmu_sc0008108.1_g000003 Rmu_sc0009414.1_g000003 Rmu_sc0010356.1_g000001 Rmu_sc0014119.1_g000002 Rmu_sc0014119.1_g000003 Rmu_sc0014161.1_g000004 Rmu_sc0023009.1_g000001 Rmu_sc0036835.1_g000001 Rmu_ssc0000204.1_g000009
rosa_roxburghii Rroxscaffold_1G00024810 Rroxscaffold_2G00110800 Rroxscaffold_2G00122430 Rroxscaffold_3G00261280 Rroxscaffold_4G00282890 Rroxscaffold_4G00330910 Rroxscaffold_5G00370350 Rroxscaffold_7G00161820
rosa_rugosa Rorug01G0389600 Rorug01G0389700 Rorug01G0389800 Rorug01G0389900 Rorug01G0389900 Rorug01G0390000 Rorug04G0343700 Rorug07G0155300
rosa_samantha Rh1AG400300 Rh1CG377300 Rh1DG394700 Rh2AG367100 Rh2BG612000 Rh2CG350500 Rh2DG389600 Rh3CG058100 Rh4AG396700 Rh4AG397100 Rh4AG397500 Rh4AG397600 Rh4AG397700 Rh4BG003000 Rh4BG127700 Rh4BG370500 Rh4BG393400 Rh4BG409200 Rh4CG035400 Rh4CG166700 Rh4CG408200 Rh4CG424700 Rh4DG028000 Rh4DG028100 Rh4DG403300 Rh4DG403800 Rh6DG080900 Rh7DG202700
rosa_wichuraiana Rw1G035540 Rw4G032760 Rw4G034230 Rw4G034240 Rw4G034260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 107
AcsI RAATTY 4 cut(s) 64, 136, 208, 258
AfaI GTAC 1 cut(s) 347
AfiI CCNNNNNNNGG 1 cut(s) 107
AflII CTTAAG 1 cut(s) 188
AgsI TTSAA 5 cut(s) 32, 79, 183, 208, 214
AluBI AGCT 3 cut(s) 75, 187, 298
AluI AGCT 3 cut(s) 75, 187, 298
Alw26I GTCTC 1 cut(s) 302
ApoI RAATTY 4 cut(s) 64, 136, 208, 258
AspS9I GGNCC 1 cut(s) 233
AsuHPI GGTGA 2 cut(s) 173, 317
AvaII GGWCC 1 cut(s) 233
BcoDI GTCTC 1 cut(s) 302
BfmI CTRYAG 1 cut(s) 10
BfrI CTTAAG 1 cut(s) 188
BglII AGATCT 1 cut(s) 112
Bme18I GGWCC 1 cut(s) 233
BmgT120I GGNCC 1 cut(s) 233
BmiI GGNNCC 1 cut(s) 293
BpuEI CTTGAG 1 cut(s) 218
BsaJI CCNNGG 2 cut(s) 106, 314
Bsc4I CCNNNNNNNGG 1 cut(s) 107
Bse1I ACTGG 2 cut(s) 235, 307
BseDI CCNNGG 2 cut(s) 106, 314
BseLI CCNNNNNNNGG 1 cut(s) 107
BseNI ACTGG 2 cut(s) 235, 307
BslI CCNNNNNNNGG 1 cut(s) 107
BsmAI GTCTC 1 cut(s) 302
Bsp143I GATC 3 cut(s) 3, 112, 280
BspLI GGNNCC 1 cut(s) 293
BspTI CTTAAG 1 cut(s) 188
BsrI ACTGG 2 cut(s) 235, 307
BssECI CCNNGG 2 cut(s) 106, 314
BssMI GATC 3 cut(s) 3, 112, 280
BssT1I CCWWGG 2 cut(s) 106, 314
Bst6I CTCTTC 1 cut(s) 84
BstAFI CTTAAG 1 cut(s) 188
BstC8I GCNNGC 1 cut(s) 102
BstDEI CTNAG 1 cut(s) 269
BstKTI GATC 3 cut(s) 6, 115, 283
BstMAI GTCTC 1 cut(s) 302
BstMBI GATC 3 cut(s) 3, 112, 280
BstSFI CTRYAG 1 cut(s) 10
BstX2I RGATCY 1 cut(s) 112
BstXI CCANNNNNNTGG 1 cut(s) 302
BstYI RGATCY 1 cut(s) 112
BtsIMutI CAGTG 1 cut(s) 300
Cac8I GCNNGC 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 233
Csp6I GTAC 1 cut(s) 346
CviAII CATG 1 cut(s) 133
CviJI RGCY 5 cut(s) 75, 104, 187, 298, 319
CviKI_1 RGCY 5 cut(s) 75, 104, 187, 298, 319
CviQI GTAC 1 cut(s) 346
DdeI CTNAG 1 cut(s) 269
DpnI GATC 3 cut(s) 5, 114, 282
DpnII GATC 3 cut(s) 3, 112, 280
Eam1104I CTCTTC 1 cut(s) 84
EarI CTCTTC 1 cut(s) 84
Eco130I CCWWGG 2 cut(s) 106, 314
Eco47I GGWCC 1 cut(s) 233
EcoT14I CCWWGG 2 cut(s) 106, 314
ErhI CCWWGG 2 cut(s) 106, 314
FaeI CATG 1 cut(s) 136
FaiI YATR 5 cut(s) 27, 37, 45, 134, 167
FatI CATG 1 cut(s) 132
Hin1II CATG 1 cut(s) 136
HincII GTYRAC 1 cut(s) 228
HindII GTYRAC 1 cut(s) 228
HindIII AAGCTT 1 cut(s) 185
HinfI GANTC 2 cut(s) 79, 128
HphI GGTGA 2 cut(s) 173, 317
Hpy166II GTNNAC 1 cut(s) 228
Hpy188I TCNGA 2 cut(s) 145, 291
Hpy188III TCNNGA 1 cut(s) 278
Hpy8I GTNNAC 1 cut(s) 228
HpyCH4V TGCA 1 cut(s) 343
HpyF3I CTNAG 1 cut(s) 269
Hsp92II CATG 1 cut(s) 136
Kzo9I GATC 3 cut(s) 3, 112, 280
LpnPI CCDG 7 cut(s) 85, 101, 114, 144, 216, 288, 308
MaeIII GTNAC 1 cut(s) 161
MalI GATC 3 cut(s) 5, 114, 282
MboI GATC 3 cut(s) 3, 112, 280
MboII GAAGA 2 cut(s) 101, 226
MflI RGATCY 1 cut(s) 112
MluCI AATT 6 cut(s) 16, 32, 64, 136, 208, 258
MnlI CCTC 1 cut(s) 193
MseI TTAA 1 cut(s) 189
MspCI CTTAAG 1 cut(s) 188
NdeII GATC 3 cut(s) 3, 112, 280
NlaIII CATG 1 cut(s) 136
NlaIV GGNNCC 1 cut(s) 293
NmuCI GTSAC 1 cut(s) 161
PfeI GAWTC 2 cut(s) 79, 128
PflMI CCANNNNNTGG 1 cut(s) 107
PspN4I GGNNCC 1 cut(s) 293
PspPI GGNCC 1 cut(s) 233
PsuI RGATCY 1 cut(s) 112
RsaI GTAC 1 cut(s) 347
RsaNI GTAC 1 cut(s) 346
SaqAI TTAA 1 cut(s) 189
Sau3AI GATC 3 cut(s) 3, 112, 280
Sau96I GGNCC 1 cut(s) 233
SetI ASST 6 cut(s) 77, 189, 198, 204, 270, 300
SfcI CTRYAG 1 cut(s) 10
SinI GGWCC 1 cut(s) 233
SmlI CTYRAG 2 cut(s) 188, 197
SmoI CTYRAG 2 cut(s) 188, 197
Sse9I AATT 6 cut(s) 16, 32, 64, 136, 208, 258
StyI CCWWGG 2 cut(s) 106, 314
TasI AATT 6 cut(s) 16, 32, 64, 136, 208, 258
TfiI GAWTC 2 cut(s) 79, 128
Tru1I TTAA 1 cut(s) 189
Tru9I TTAA 1 cut(s) 189
TscAI CASTG 1 cut(s) 307
TseFI GTSAC 1 cut(s) 161
Tsp45I GTSAC 1 cut(s) 161
TspDTI ATGAA 1 cut(s) 149
TspGWI ACGGA 1 cut(s) 144
TspRI CASTG 1 cut(s) 307
Van91I CCANNNNNTGG 1 cut(s) 107
Vha464I CTTAAG 1 cut(s) 188
VpaK11BI GGWCC 1 cut(s) 233
XapI RAATTY 4 cut(s) 64, 136, 208, 258
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.