Rorug01G0351700

disease resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0000390
Physical Location & Seq
Forward (+)
46898959 .. 46902675
3717 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0351700.1

Sequence Viewer

Length: 1044 bp
ATGTCAGCCCTTGTGCTCAAAATGACCACAGCAACCTCTCCTATAAAACCCCACCCCCAAAATCTCCTCCTCCCCAATTGGGTCCGCCCTCGTTCTCTCTCTCGCTCCTCCTTCACAACCACCCACCACCCAACAACCCTCCAAACCCAAAACCAAAACCAAAATAAGAATCTCAAATACAAGTGGTGGAGGATAACACCACCCTCCTCAAGTCTCCTGCTTGGGCCCAGATTCCGCGGCCCACATAAATGCCTGGCCATTTCTCCATCTTCTTCATCTGCTAGCGGCGGTCGCTCCGAGAATCAAGGAGAGGGTGGTCTTATGGCCGATATGGGTTCCCAGAATCATAAAGGCCATGAGTGGTTCGACAGCAAATTGTACGCTGATAAAGACGGATTGCTTTCCCCTAATCACGATGACCAATCAACGCCGCCTCCTCATCAATCGCCTAAATTGCTCACCTTGCCCACCATTCTCACCCTCGGCCGCGTCGCCGCCGTGCCCGTTCTCATCACCACTTTCTATGTGGATAGTTGGTTGGGAAAAACTGCTACAACAAGTATATTCATCGCTGCGGCGATTACTGACTGGCTTGATGGCTATCTTGCTCGCAAGATGAGGTTAGGATCTGCTTTTGGTGCATTTCTGGATCCAGTCGCTGATAAGCTCATGGTTGCTGCTACGCTGGTTTTATTGTGCTCCAGACCTCAAGATGTTGCTGCATTTGGGCAAGTGCCATGGCTATTGGTTGTTCCTTCAATTGCCATAATAGGTAGAGAGATAACCATGTCTGCAGTTAGAGAATGGGCTGCTTCTCAGAACGCCAAGCTTTTAGAGGCTGTTGCTGTAAATAACTTGGGAAAGTGGAAAACAGCCACACAGATGATCGCACTAACTATCCTCTTGGCCACCCGAGATAGCAGTCTTGGAGGGCCAGAGTTTGTAGTAGCTTCTGGGGTTGTTCTGCTTTATATATCAGCAGGGCTTGCTGTATGGTCTTTAGCTGTGTATATGAGCAAGATATGGAAAGTACTGCTGAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

347

Amino Acids

37.73

Weight (kDa)

9.86

Isoelectric Point (pI)

47.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CDP-OH_P_transf PF01066 154 - 332 1.3e-29 CDP-alcohol phosphatidyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000390)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g18050 FvH4_7g18050
malus_domestica MD07G1206200.v1.1 MD07G1206400.v1.1 MD07G1206500.v1.1 MD07G1206700.v1.1 MD07G1207000.v1.1 MD07G1207100.v1.1 MD07G1207200.v1.1
prunus_persica Prupe.2G166200_v2.0.a1 Prupe.2G242000_v2.0.a1 Prupe.2G242100_v2.0.a1 Prupe.2G242100_v2.0.a1 Prupe.2G242200_v2.0.a1 Prupe.2G242200_v2.0.a1 Prupe.2G242400_v2.0.a1
pyrus_communis pycom07g19260 pycom07g19280 pycom07g19290
rosa_chinensis RchiOBHm_Chr1g0325901 RchiOBHm_Chr1g0325961 RchiOBHm_Chr1g0344281 RchiOBHm_Chr1g0344291 RchiOBHm_Chr1g0344301 RchiOBHm_Chr1g0368771 RchiOBHm_Chr1g0369141 RchiOBHm_Chr1g0369281 RchiOBHm_Chr1g0369291 RchiOBHm_Chr1g0369661 RchiOBHm_Chr1g0370161 RchiOBHm_Chr4g0396401
rosa_laevigata RLG00000009546 RLG00000027070 RLG00000027140 RLG00000027151 RLG00000027152 RLG00000027190 RLG00000027255 RLG00000028909 RLG00000030094 RLG00000030097
rosa_multiflora Rmu_co8196240.1_g000001 Rmu_co8379125.1_g000001 Rmu_co8402573.1_g000001 Rmu_co8479243.1_g000001 Rmu_sc0000019.1_g000019 Rmu_sc0001154.1_g000009 Rmu_sc0001482.1_g000014 Rmu_sc0004250.1_g000009 Rmu_sc0006696.1_g000002 Rmu_sc0006696.1_g000004 Rmu_sc0008679.1_g000018 Rmu_sc0009743.1_g000003 Rmu_sc0013657.1_g000023
rosa_roxburghii Rroxscaffold_4G00286760 Rroxscaffold_4G00287250 Rroxscaffold_4G00287470 Rroxscaffold_4G00287770 Rroxscaffold_4G00287930 Rroxscaffold_4G00309920 Rroxscaffold_4G00324120
rosa_rugosa Rorug01G0055900 Rorug01G0173100 Rorug01G0173200 Rorug01G0337700 Rorug01G0337800 Rorug01G0337800 Rorug01G0337800 Rorug01G0344900 Rorug01G0349400 Rorug01G0349400 Rorug01G0351700 Rorug01G0354500
rosa_samantha Rh1AG072300 Rh1AG189000 Rh1AG189100 Rh1AG351900 Rh1AG356500 Rh1AG359800 Rh1AG363200 Rh1BG059100 Rh1BG155800 Rh1BG306800 Rh1BG315600 Rh1BG319000 Rh1BG320300 Rh1BG326300 Rh1BG326400 Rh1CG071600 Rh1CG174600 Rh1CG174800 Rh1CG322400 Rh1CG330300 Rh1CG334200 Rh1CG339600
rosa_wichuraiana Rw1G005870 Rw1G005900 Rw1G015560 Rw1G031350 Rw1G031470 Rw1G031700 Rw1G031960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 237, 489
AciI CCGC 9 cut(s) 85, 235, 237, 285, 288, 431, 487, 495, 575
AclWI GGATC 3 cut(s) 634, 644, 657
AcoI YGGCCR 4 cut(s) 255, 324, 484, 906
AfaI GTAC 2 cut(s) 380, 1032
AfiI CCNNNNNNNGG 1 cut(s) 79
AgsI TTSAA 1 cut(s) 759
AjnI CCWGG 1 cut(s) 252
AluBI AGCT 4 cut(s) 667, 829, 950, 1004
AluI AGCT 4 cut(s) 667, 829, 950, 1004
Alw21I GWGCWC 2 cut(s) 18, 701
Alw26I GTCTC 1 cut(s) 218
AlwI GGATC 3 cut(s) 634, 644, 657
AlwNI CAGNNNCTG 1 cut(s) 659
Ama87I CYCGRG 1 cut(s) 912
AoxI GGCC 8 cut(s) 224, 238, 255, 324, 352, 484, 906, 932
ApaI GGGCCC 1 cut(s) 228
ApeKI GCWGC 4 cut(s) 572, 677, 719, 809
AspS9I GGNCC 5 cut(s) 82, 224, 225, 239, 932
AsuHPI GGTGA 3 cut(s) 451, 469, 505
AsuNHI GCTAGC 1 cut(s) 281
AvaI CYCGRG 1 cut(s) 912
AvaII GGWCC 1 cut(s) 82
BaeGI GKGCMC 2 cut(s) 228, 504
BalI TGGCCA 2 cut(s) 257, 908
BamHI GGATCC 1 cut(s) 649
BanII GRGCYC 1 cut(s) 228
Bbv12I GWGCWC 2 cut(s) 18, 701
BbvCI CCTCAGC 1 cut(s) 1037
BbvI GCAGC 4 cut(s) 559, 664, 706, 796
BccI CCATC 2 cut(s) 274, 590
BceAI ACGGC 1 cut(s) 482
BciT130I CCWGG 1 cut(s) 254
BcoDI GTCTC 1 cut(s) 218
BfaI CTAG 1 cut(s) 282
BfmI CTRYAG 1 cut(s) 792
BmcAI AGTACT 1 cut(s) 1032
Bme1390I CCNGG 1 cut(s) 254
Bme18I GGWCC 1 cut(s) 82
BmeT110I CYCGRG 1 cut(s) 912
BmgT120I GGNCC 5 cut(s) 82, 224, 225, 239, 932
BmiI GGNNCC 4 cut(s) 83, 226, 337, 651
BmrFI CCNGG 1 cut(s) 254
BmtI GCTAGC 1 cut(s) 285
BpmI CTGGAG 1 cut(s) 685
Bpu10I CCTNAGC 1 cut(s) 1037
BpuEI CTTGAG 2 cut(s) 193, 693
BsaBI GATNNNNATC 1 cut(s) 600
BsaJI CCNNGG 3 cut(s) 235, 481, 737
BsaXI ACNNNNNCTCC 2 cut(s) 418, 448
Bsc4I CCNNNNNNNGG 1 cut(s) 79
Bse1I ACTGG 2 cut(s) 593, 653
Bse8I GATNNNNATC 1 cut(s) 600
BseBI CCWGG 1 cut(s) 254
BseDI CCNNGG 3 cut(s) 235, 481, 737
BseJI GATNNNNATC 1 cut(s) 600
BseLI CCNNNNNNNGG 1 cut(s) 79
BseMII CTCAG 2 cut(s) 830, 1028
BseNI ACTGG 2 cut(s) 593, 653
BseRI GAGGAG 5 cut(s) 56, 59, 97, 196, 426
BseSI GKGCMC 2 cut(s) 228, 504
BseX3I CGGCCG 1 cut(s) 484
BseXI GCAGC 4 cut(s) 559, 664, 706, 796
Bsh1236I CGCG 2 cut(s) 237, 489
Bsh1285I CGRYCG 2 cut(s) 292, 487
BshFI GGCC 8 cut(s) 226, 240, 257, 326, 354, 486, 908, 934
BsiEI CGRYCG 2 cut(s) 292, 487
BsiHKAI GWGCWC 2 cut(s) 18, 701
BsiHKCI CYCGRG 1 cut(s) 912
BslI CCNNNNNNNGG 1 cut(s) 79
BsmAI GTCTC 1 cut(s) 218
BsnI GGCC 8 cut(s) 226, 240, 257, 326, 354, 486, 908, 934
BsoBI CYCGRG 1 cut(s) 912
Bsp120I GGGCCC 1 cut(s) 224
Bsp1286I GDGCHC 4 cut(s) 18, 228, 504, 701
Bsp143I GATC 3 cut(s) 626, 649, 885
Bsp19I CCATGG 1 cut(s) 737
BspACI CCGC 9 cut(s) 85, 235, 237, 285, 288, 431, 487, 495, 575
BspANI GGCC 8 cut(s) 226, 240, 257, 326, 354, 486, 908, 934
BspCNI CTCAG 2 cut(s) 829, 1029
BspFNI CGCG 2 cut(s) 237, 489
BspLI GGNNCC 4 cut(s) 83, 226, 337, 651
BspMAI CTGCAG 1 cut(s) 796
BspOI GCTAGC 1 cut(s) 285
BspPI GGATC 3 cut(s) 634, 644, 657
BsrI ACTGG 2 cut(s) 593, 653
BssECI CCNNGG 3 cut(s) 235, 481, 737
BssMI GATC 3 cut(s) 626, 649, 885
BssT1I CCWWGG 1 cut(s) 737
Bst2UI CCWGG 1 cut(s) 254
BstAPI GCANNNNNTGC 1 cut(s) 986
BstC8I GCNNGC 3 cut(s) 283, 610, 987
BstDEI CTNAG 2 cut(s) 816, 1037
BstDSI CCRYGG 2 cut(s) 235, 737
BstFNI CGCG 2 cut(s) 237, 489
BstKTI GATC 3 cut(s) 629, 652, 888
BstMAI GTCTC 1 cut(s) 218
BstMBI GATC 3 cut(s) 626, 649, 885
BstMCI CGRYCG 2 cut(s) 292, 487
BstMWI GCNNNNNNNGC 5 cut(s) 291, 454, 463, 638, 986
BstNI CCWGG 1 cut(s) 254
BstSCI CCNGG 1 cut(s) 252
BstSFI CTRYAG 1 cut(s) 792
BstSLI GKGCMC 2 cut(s) 228, 504
BstUI CGCG 2 cut(s) 237, 489
BstV1I GCAGC 4 cut(s) 559, 664, 706, 796
BstX2I RGATCY 2 cut(s) 626, 649
BstYI RGATCY 2 cut(s) 626, 649
BstZI CGGCCG 1 cut(s) 484
BsuRI GGCC 8 cut(s) 226, 240, 257, 326, 354, 486, 908, 934
BtgI CCRYGG 2 cut(s) 235, 737
BtgZI GCGATG 1 cut(s) 553
Cac8I GCNNGC 3 cut(s) 283, 610, 987
CaiI CAGNNNCTG 1 cut(s) 659
Cfr13I GGNCC 5 cut(s) 82, 224, 225, 239, 932
Cfr42I CCGCGG 1 cut(s) 238
CseI GACGC 1 cut(s) 478
Csp6I GTAC 2 cut(s) 379, 1031
CviAII CATG 4 cut(s) 356, 670, 738, 787
CviQI GTAC 2 cut(s) 379, 1031
DdeI CTNAG 2 cut(s) 816, 1037
DpnI GATC 3 cut(s) 628, 651, 887
DpnII GATC 3 cut(s) 626, 649, 885
EaeI YGGCCR 4 cut(s) 255, 324, 484, 906
EagI CGGCCG 1 cut(s) 484
EciI GGCGGA 1 cut(s) 74
EclXI CGGCCG 1 cut(s) 484
Eco130I CCWWGG 1 cut(s) 737
Eco24I GRGCYC 1 cut(s) 228
Eco47I GGWCC 1 cut(s) 82
Eco52I CGGCCG 1 cut(s) 484
Eco88I CYCGRG 1 cut(s) 912
EcoRII CCWGG 1 cut(s) 252
EcoT14I CCWWGG 1 cut(s) 737
EcoT38I GRGCYC 1 cut(s) 228
ErhI CCWWGG 1 cut(s) 737
FaeI CATG 4 cut(s) 359, 673, 741, 790
FatI CATG 4 cut(s) 355, 669, 737, 786
FriOI GRGCYC 1 cut(s) 228
FspBI CTAG 1 cut(s) 282
GsuI CTGGAG 1 cut(s) 685
HaeIII GGCC 8 cut(s) 226, 240, 257, 326, 354, 486, 908, 934
HgaI GACGC 1 cut(s) 478
Hin1II CATG 4 cut(s) 359, 673, 741, 790
HindIII AAGCTT 1 cut(s) 827
HinfI GANTC 4 cut(s) 169, 231, 301, 343
HphI GGTGA 3 cut(s) 451, 469, 505
Hpy188I TCNGA 2 cut(s) 298, 819
Hpy188III TCNNGA 4 cut(s) 413, 647, 702, 710
Hpy99I CGWCG 1 cut(s) 494
HpyAV CCTTC 2 cut(s) 121, 765
HpyCH4V TGCA 3 cut(s) 641, 722, 794
HpyF10VI GCNNNNNNNGC 5 cut(s) 291, 454, 463, 638, 986
HpyF3I CTNAG 2 cut(s) 816, 1037
Hsp92II CATG 4 cut(s) 359, 673, 741, 790
KspI CCGCGG 1 cut(s) 238
Kzo9I GATC 3 cut(s) 626, 649, 885
LmnI GCTCC 3 cut(s) 110, 299, 704
Lsp1109I GCAGC 4 cut(s) 559, 664, 706, 796
MaeI CTAG 1 cut(s) 282
MalI GATC 3 cut(s) 628, 651, 887
MboI GATC 3 cut(s) 626, 649, 885
MboII GAAGA 2 cut(s) 261, 264
MfeI CAATTG 2 cut(s) 76, 759
MflI RGATCY 2 cut(s) 626, 649
MhlI GDGCHC 4 cut(s) 18, 228, 504, 701
MlsI TGGCCA 2 cut(s) 257, 908
MluCI AATT 4 cut(s) 76, 374, 452, 759
MluNI TGGCCA 2 cut(s) 257, 908
Mox20I TGGCCA 2 cut(s) 257, 908
MscI TGGCCA 2 cut(s) 257, 908
MslI CAYNNNNRTG 2 cut(s) 247, 881
Msp20I TGGCCA 2 cut(s) 257, 908
MspA1I CMGCKG 1 cut(s) 237
MspR9I CCNGG 1 cut(s) 254
MunI CAATTG 2 cut(s) 76, 759
MvaI CCWGG 1 cut(s) 254
MvnI CGCG 2 cut(s) 237, 489
MwoI GCNNNNNNNGC 5 cut(s) 291, 454, 463, 638, 986
NcoI CCATGG 1 cut(s) 737
NdeII GATC 3 cut(s) 626, 649, 885
NheI GCTAGC 1 cut(s) 281
NlaIII CATG 4 cut(s) 359, 673, 741, 790
NlaIV GGNNCC 4 cut(s) 83, 226, 337, 651
NmeAIII GCCGAG 1 cut(s) 462
PfeI GAWTC 4 cut(s) 169, 231, 301, 343
Psp6I CCWGG 1 cut(s) 252
PspGI CCWGG 1 cut(s) 252
PspN4I GGNNCC 4 cut(s) 83, 226, 337, 651
PspOMI GGGCCC 1 cut(s) 224
PspPI GGNCC 5 cut(s) 82, 224, 225, 239, 932
PstI CTGCAG 1 cut(s) 796
PstNI CAGNNNCTG 1 cut(s) 659
PsuI RGATCY 2 cut(s) 626, 649
RsaI GTAC 2 cut(s) 380, 1032
RsaNI GTAC 2 cut(s) 379, 1031
RseI CAYNNNNRTG 2 cut(s) 247, 881
SacII CCGCGG 1 cut(s) 238
Sau3AI GATC 3 cut(s) 626, 649, 885
Sau96I GGNCC 5 cut(s) 82, 224, 225, 239, 932
ScaI AGTACT 1 cut(s) 1032
ScrFI CCNGG 1 cut(s) 254
SduI GDGCHC 4 cut(s) 18, 228, 504, 701
SfcI CTRYAG 1 cut(s) 792
Sfr303I CCGCGG 1 cut(s) 238
SgrBI CCGCGG 1 cut(s) 238
SinI GGWCC 1 cut(s) 82
SmiMI CAYNNNNRTG 2 cut(s) 247, 881
SmlI CTYRAG 2 cut(s) 208, 708
SmoI CTYRAG 2 cut(s) 208, 708
Sse9I AATT 4 cut(s) 76, 374, 452, 759
SsiI CCGC 9 cut(s) 85, 235, 237, 285, 288, 431, 487, 495, 575
SspMI CTAG 1 cut(s) 282
StyD4I CCNGG 1 cut(s) 252
StyI CCWWGG 1 cut(s) 737
TaqI TCGA 1 cut(s) 366
TasI AATT 4 cut(s) 76, 374, 452, 759
TatI WGTACW 1 cut(s) 1030
TauI GCSGC 6 cut(s) 240, 288, 433, 489, 497, 578
TfiI GAWTC 4 cut(s) 169, 231, 301, 343
TseI GCWGC 4 cut(s) 572, 677, 719, 809
TspDTI ATGAA 2 cut(s) 264, 556
TspGWI ACGGA 1 cut(s) 408
VpaK11BI GGWCC 1 cut(s) 82
XcmI CCANNNNNNNNNTGG 1 cut(s) 523
XspI CTAG 1 cut(s) 282
ZrmI AGTACT 1 cut(s) 1032
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.