RchiOBHm_Chr4g0395221
MYB Family

At2g29880-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0000329
Physical Location & Seq
Reverse (-)
10988697 .. 10989292
596 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36767

Sequence Viewer

Length: 426 bp
ATGTTCGTGCAAAGTGAAAATGAGTCATCACACCAAGAAAACTCGCCATCTCTTTCACAACAACCCTTCCAAGGTACCAATGTAGATGCTCCACCACATAGCAGGACTCAAGGAAAACGGAGTAGGACTGACTATGAAAATAATAGCGGCTCAAAGGGGGCAACTAGTCAGGCTGAGGTTTTAGAAAACTTATCAAGTGGCATTGGTAAAATTGTCACAAGTTTTGATAAAATTTGTGGCTTAATGGAGAAGAGAGAATCAAGAGAGAGTGATCTTTTGGATGCTATGAACGAGACCCCAGGATTAACTGATGAGGCTTGCTTTATGGCTCTTGATTTGCTTAATACTAAAGCAAAGCAAGATTTCTTCTTGAAGATGACTCCTGAACAACGACATAATTGGATCACCTATAAACAAATGCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

141

Amino Acids

15.85

Weight (kDa)

5.19

Isoelectric Point (pI)

52.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
At2g29880_C PF24769 94 - 138 2.2e-20 At2g29880 C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000329)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g00551 FvH4_2g33311 FvH4_4g17330 FvH4_5g24690 FvH4_6g24700
rosa_chinensis RchiOBHm_Chr3g0476481 RchiOBHm_Chr3g0497311 RchiOBHm_Chr4g0395221 RchiOBHm_Chr4g0409291 RchiOBHm_Chr5g0019361 RchiOBHm_Chr5g0052631 RchiOBHm_Chr6g0281401 RchiOBHm_Chr6g0297421 RchiOBHm_Chr7g0220391 RchiOBHm_Chr7g0237991
rosa_laevigata RLG00000000925 RLG00000001165 RLG00000001356 RLG00000001477 RLG00000002205 RLG00000002538 RLG00000003099 RLG00000003549 RLG00000003988 RLG00000008622 RLG00000008839 RLG00000010965 RLG00000011510 RLG00000012037 RLG00000013215 RLG00000013450 RLG00000015007 RLG00000017503 RLG00000019169 RLG00000019298 RLG00000020522 RLG00000021241 RLG00000021700 RLG00000022934 RLG00000022935 RLG00000023200 RLG00000026869 RLG00000028902 RLG00000030978 RLG00000032525 RLG00000033761 RLG00000034460 RLG00000034510 RLG00000034626 RLG00000035597 RLG00000035815 RLG00000036785 RLG00000037002
rosa_multiflora Rmu_sc0000147.1_g000040 Rmu_sc0000429.1_g000095 Rmu_sc0002357.1_g000041 Rmu_sc0003113.1_g000004 Rmu_sc0003426.1_g000006 Rmu_sc0004453.1_g000001 Rmu_sc0004455.1_g000005 Rmu_sc0004511.1_g000002 Rmu_sc0005782.1_g000003 Rmu_sc0007848.1_g000030 Rmu_sc0007863.1_g000005 Rmu_sc0008256.1_g000001 Rmu_sc0011325.1_g000005 Rmu_sc0012624.1_g000004 Rmu_sc0017974.1_g000002 Rmu_sc0018061.1_g000001 Rmu_ssc0000366.1_g000011 Rmu_ssc0000472.1_g000025
rosa_roxburghii Rroxscaffold_1G00010100 Rroxscaffold_1G00031270 Rroxscaffold_2G00108870 Rroxscaffold_2G00131670 Rroxscaffold_2G00142200 Rroxscaffold_3G00233060 Rroxscaffold_3G00233710 Rroxscaffold_4G00300200 Rroxscaffold_4G00318490 Rroxscaffold_4G00319390 Rroxscaffold_5G00340520 Rroxscaffold_5G00349510 Rroxscaffold_5G00374060 Rroxscaffold_6G00393340 Rroxscaffold_6G00405620 Rroxscaffold_6G00411840 Rroxscaffold_7G00187660
rosa_rugosa Rorug01G0090600 Rorug01G0091800 Rorug01G0168700 Rorug01G0192800 Rorug02G0326300 Rorug02G0353900 Rorug02G0354000 Rorug02G0408500 Rorug03G0151400 Rorug05G0150800 Rorug05G0150900 Rorug05G0407400 Rorug06G0111000
rosa_samantha Rh3DG370900
rosa_wichuraiana Rw1G001900 Rw2G022570 Rw3G020950 Rw3G028020 Rw4G009960 Rw5G032340 Rw6G003630 Rw6G018060 Rw7G024540 Rw7G035380

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 74
AccB1I GGYRCC 1 cut(s) 74
AciI CCGC 1 cut(s) 147
AclWI GGATC 1 cut(s) 410
AcsI RAATTY 1 cut(s) 231
AfaI GTAC 1 cut(s) 76
AfiI CCNNNNNNNGG 1 cut(s) 71
AgsI TTSAA 1 cut(s) 373
AhlI ACTAGT 1 cut(s) 164
AjnI CCWGG 1 cut(s) 298
Alw26I GTCTC 1 cut(s) 287
AlwI GGATC 1 cut(s) 410
ApoI RAATTY 1 cut(s) 231
Asp718I GGTACC 1 cut(s) 74
AsuHPI GGTGA 1 cut(s) 397
BaeI ACNNNNGTAYC 2 cut(s) 66, 99
BanI GGYRCC 1 cut(s) 74
BbvCI CCTCAGC 1 cut(s) 174
BccI CCATC 1 cut(s) 55
BciT130I CCWGG 1 cut(s) 300
BcoDI GTCTC 1 cut(s) 287
BcuI ACTAGT 1 cut(s) 164
BfaI CTAG 1 cut(s) 165
BisI GCNGC 1 cut(s) 148
BlsI GCNGC 1 cut(s) 149
Bme1390I CCNGG 1 cut(s) 300
BmiI GGNNCC 1 cut(s) 76
BmrFI CCNGG 1 cut(s) 300
BmsI GCATC 2 cut(s) 76, 271
Bpu10I CCTNAGC 1 cut(s) 174
BpuEI CTTGAG 1 cut(s) 93
BsaI GGTCTC 1 cut(s) 287
BsaJI CCNNGG 2 cut(s) 70, 298
Bsc4I CCNNNNNNNGG 1 cut(s) 71
BseBI CCWGG 1 cut(s) 300
BseDI CCNNGG 2 cut(s) 70, 298
BseGI GGATG 1 cut(s) 286
BseLI CCNNNNNNNGG 1 cut(s) 71
BseMII CTCAG 1 cut(s) 165
BshNI GGYRCC 1 cut(s) 74
BslI CCNNNNNNNGG 1 cut(s) 71
BsmAI GTCTC 1 cut(s) 287
Bso31I GGTCTC 1 cut(s) 287
Bsp143I GATC 2 cut(s) 271, 402
BspACI CCGC 1 cut(s) 147
BspCNI CTCAG 1 cut(s) 166
BspLI GGNNCC 1 cut(s) 76
BspPI GGATC 1 cut(s) 410
BspT107I GGYRCC 1 cut(s) 74
BspTNI GGTCTC 1 cut(s) 287
BssECI CCNNGG 2 cut(s) 70, 298
BssMI GATC 2 cut(s) 271, 402
BssT1I CCWWGG 1 cut(s) 70
Bst2UI CCWGG 1 cut(s) 300
Bst6I CTCTTC 1 cut(s) 245
BstC8I GCNNGC 1 cut(s) 319
BstDEI CTNAG 1 cut(s) 174
BstF5I GGATG 1 cut(s) 286
BstKTI GATC 2 cut(s) 274, 405
BstMAI GTCTC 1 cut(s) 287
BstMBI GATC 2 cut(s) 271, 402
BstNI CCWGG 1 cut(s) 300
BstSCI CCNGG 1 cut(s) 298
BtsCI GGATG 1 cut(s) 286
Cac8I GCNNGC 1 cut(s) 319
Csp6I GTAC 1 cut(s) 75
CviJI RGCY 5 cut(s) 150, 173, 240, 317, 329
CviKI_1 RGCY 5 cut(s) 150, 173, 240, 317, 329
CviQI GTAC 1 cut(s) 75
DdeI CTNAG 1 cut(s) 174
DpnI GATC 2 cut(s) 273, 404
DpnII GATC 2 cut(s) 271, 402
Eam1104I CTCTTC 1 cut(s) 245
EarI CTCTTC 1 cut(s) 245
Eco130I CCWWGG 1 cut(s) 70
Eco31I GGTCTC 1 cut(s) 287
EcoRII CCWGG 1 cut(s) 298
EcoT14I CCWWGG 1 cut(s) 70
ErhI CCWWGG 1 cut(s) 70
FaiI YATR 6 cut(s) 99, 135, 287, 326, 396, 411
Fnu4HI GCNGC 1 cut(s) 148
FokI GGATG 1 cut(s) 293
Fsp4HI GCNGC 1 cut(s) 148
FspBI CTAG 1 cut(s) 165
GluI GCNGC 1 cut(s) 148
HinfI GANTC 4 cut(s) 23, 106, 257, 379
HphI GGTGA 1 cut(s) 397
Hpy188III TCNNGA 4 cut(s) 261, 332, 370, 383
HpyAV CCTTC 1 cut(s) 76
HpyCH4V TGCA 2 cut(s) 10, 421
HpyF3I CTNAG 1 cut(s) 174
KpnI GGTACC 1 cut(s) 78
Kzo9I GATC 2 cut(s) 271, 402
LmnI GCTCC 1 cut(s) 94
LpnPI CCDG 5 cut(s) 88, 155, 285, 312, 396
LweI GCATC 2 cut(s) 76, 271
MaeI CTAG 1 cut(s) 165
MaeIII GTNAC 1 cut(s) 214
MalI GATC 2 cut(s) 273, 404
MboI GATC 2 cut(s) 271, 402
MboII GAAGA 3 cut(s) 262, 358, 385
MluCI AATT 3 cut(s) 210, 231, 397
MlyI GAGTC 3 cut(s) 32, 100, 373
MnlI CCTC 2 cut(s) 169, 307
MseI TTAA 3 cut(s) 242, 305, 342
MspR9I CCNGG 1 cut(s) 300
MvaI CCWGG 1 cut(s) 300
NdeII GATC 2 cut(s) 271, 402
NlaIV GGNNCC 1 cut(s) 76
NmuCI GTSAC 1 cut(s) 214
PfeI GAWTC 1 cut(s) 257
PkrI GCNGC 1 cut(s) 149
PleI GAGTC 3 cut(s) 31, 100, 373
PpsI GAGTC 3 cut(s) 31, 100, 373
Psp6I CCWGG 1 cut(s) 298
PspGI CCWGG 1 cut(s) 298
PspN4I GGNNCC 1 cut(s) 76
RsaI GTAC 1 cut(s) 76
RsaNI GTAC 1 cut(s) 75
SaqAI TTAA 3 cut(s) 242, 305, 342
SatI GCNGC 1 cut(s) 148
Sau3AI GATC 2 cut(s) 271, 402
SchI GAGTC 3 cut(s) 32, 100, 373
ScrFI CCNGG 1 cut(s) 300
SetI ASST 3 cut(s) 76, 180, 410
SfaNI GCATC 2 cut(s) 76, 271
SmlI CTYRAG 1 cut(s) 108
SmoI CTYRAG 1 cut(s) 108
SpeI ACTAGT 1 cut(s) 164
Sse9I AATT 3 cut(s) 210, 231, 397
SsiI CCGC 1 cut(s) 147
SspMI CTAG 1 cut(s) 165
StyD4I CCNGG 1 cut(s) 298
StyI CCWWGG 1 cut(s) 70
TasI AATT 3 cut(s) 210, 231, 397
TauI GCSGC 1 cut(s) 150
TfiI GAWTC 1 cut(s) 257
Tru1I TTAA 3 cut(s) 242, 305, 342
Tru9I TTAA 3 cut(s) 242, 305, 342
TseFI GTSAC 1 cut(s) 214
Tsp45I GTSAC 1 cut(s) 214
TspDTI ATGAA 2 cut(s) 150, 302
TspGWI ACGGA 1 cut(s) 133
XapI RAATTY 1 cut(s) 231
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.