Rmu_sc0000429.1_g000095
MYB Family

At2g29880-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000429.1
Physical Location & Seq
Reverse (-)
447140 .. 447532
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000429.1_g000095.1.cds

Sequence Viewer

Length: 276 bp
atgcgttttagctccggttttggatttgattcaactacaaagaggttcactgcttctaatgaagcatgggaggaataccttaaggacaccgacttgcgctatgggacatttgatgattatgaggacttggaaattgctattgggaatggtgtagcggttgggaaaaacttggtcgggttgggtagtgttaccgatgcaagaacattaggtgttggagaagatagagaaggttatgatgataatgaggttggaatggatgagtatgcagctttctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.04

Weight (kDa)

4.07

Isoelectric Point (pI)

21.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000329)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g00551 FvH4_2g33311 FvH4_4g17330 FvH4_5g24690 FvH4_6g24700
rosa_chinensis RchiOBHm_Chr3g0476481 RchiOBHm_Chr3g0497311 RchiOBHm_Chr4g0395221 RchiOBHm_Chr4g0409291 RchiOBHm_Chr5g0019361 RchiOBHm_Chr5g0052631 RchiOBHm_Chr6g0281401 RchiOBHm_Chr6g0297421 RchiOBHm_Chr7g0220391 RchiOBHm_Chr7g0237991
rosa_laevigata RLG00000000925 RLG00000001165 RLG00000001356 RLG00000001477 RLG00000002205 RLG00000002538 RLG00000003099 RLG00000003549 RLG00000003988 RLG00000008622 RLG00000008839 RLG00000010965 RLG00000011510 RLG00000012037 RLG00000013215 RLG00000013450 RLG00000015007 RLG00000017503 RLG00000019169 RLG00000019298 RLG00000020522 RLG00000021241 RLG00000021700 RLG00000022934 RLG00000022935 RLG00000023200 RLG00000026869 RLG00000028902 RLG00000030978 RLG00000032525 RLG00000033761 RLG00000034460 RLG00000034510 RLG00000034626 RLG00000035597 RLG00000035815 RLG00000036785 RLG00000037002
rosa_multiflora Rmu_sc0000147.1_g000040 Rmu_sc0000429.1_g000095 Rmu_sc0002357.1_g000041 Rmu_sc0003113.1_g000004 Rmu_sc0003426.1_g000006 Rmu_sc0004453.1_g000001 Rmu_sc0004455.1_g000005 Rmu_sc0004511.1_g000002 Rmu_sc0005782.1_g000003 Rmu_sc0007848.1_g000030 Rmu_sc0007863.1_g000005 Rmu_sc0008256.1_g000001 Rmu_sc0011325.1_g000005 Rmu_sc0012624.1_g000004 Rmu_sc0017974.1_g000002 Rmu_sc0018061.1_g000001 Rmu_ssc0000366.1_g000011 Rmu_ssc0000472.1_g000025
rosa_roxburghii Rroxscaffold_1G00010100 Rroxscaffold_1G00031270 Rroxscaffold_2G00108870 Rroxscaffold_2G00131670 Rroxscaffold_2G00142200 Rroxscaffold_3G00233060 Rroxscaffold_3G00233710 Rroxscaffold_4G00300200 Rroxscaffold_4G00318490 Rroxscaffold_4G00319390 Rroxscaffold_5G00340520 Rroxscaffold_5G00349510 Rroxscaffold_5G00374060 Rroxscaffold_6G00393340 Rroxscaffold_6G00405620 Rroxscaffold_6G00411840 Rroxscaffold_7G00187660
rosa_rugosa Rorug01G0090600 Rorug01G0091800 Rorug01G0168700 Rorug01G0192800 Rorug02G0326300 Rorug02G0353900 Rorug02G0354000 Rorug02G0408500 Rorug03G0151400 Rorug05G0150800 Rorug05G0150900 Rorug05G0407400 Rorug06G0111000
rosa_samantha Rh3DG370900
rosa_wichuraiana Rw1G001900 Rw2G022570 Rw3G020950 Rw3G028020 Rw4G009960 Rw5G032340 Rw6G003630 Rw6G018060 Rw7G024540 Rw7G035380

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 155
AflII CTTAAG 1 cut(s) 80
AgsI TTSAA 1 cut(s) 33
AjuI GAANNNNNNNTTGG 2 cut(s) 123, 155
AluBI AGCT 2 cut(s) 12, 269
AluI AGCT 2 cut(s) 12, 269
ApeKI GCWGC 1 cut(s) 266
AspLEI GCGC 1 cut(s) 99
BfrI CTTAAG 1 cut(s) 80
BisI GCNGC 1 cut(s) 267
BlsI GCNGC 1 cut(s) 268
BmsI GCATC 1 cut(s) 184
BsaWI WCCGGW 1 cut(s) 14
BseGI GGATG 1 cut(s) 262
BsiSI CCGG 1 cut(s) 15
BslFI GGGAC 1 cut(s) 118
BsmFI GGGAC 1 cut(s) 118
BspACI CCGC 1 cut(s) 155
BspTI CTTAAG 1 cut(s) 80
BstAFI CTTAAG 1 cut(s) 80
BstF5I GGATG 1 cut(s) 262
BstHHI GCGC 1 cut(s) 99
BtsCI GGATG 1 cut(s) 262
BtsI GCAGTG 1 cut(s) 48
BtsIMutI CAGTG 1 cut(s) 48
CfoI GCGC 1 cut(s) 99
CviAII CATG 1 cut(s) 66
CviJI RGCY 2 cut(s) 12, 269
CviKI_1 RGCY 2 cut(s) 12, 269
FaeI CATG 1 cut(s) 69
FaiI YATR 5 cut(s) 67, 102, 120, 234, 264
FaqI GGGAC 1 cut(s) 118
FatI CATG 1 cut(s) 65
Fnu4HI GCNGC 1 cut(s) 267
FokI GGATG 1 cut(s) 269
Fsp4HI GCNGC 1 cut(s) 267
GlaI GCGC 1 cut(s) 98
GluI GCNGC 1 cut(s) 267
HapII CCGG 1 cut(s) 15
HhaI GCGC 1 cut(s) 99
Hin1II CATG 1 cut(s) 69
Hin6I GCGC 1 cut(s) 97
HinP1I GCGC 1 cut(s) 97
HinfI GANTC 1 cut(s) 29
HpaII CCGG 1 cut(s) 15
Hpy166II GTNNAC 1 cut(s) 48
Hpy8I GTNNAC 1 cut(s) 48
HpyAV CCTTC 1 cut(s) 221
HpyCH4V TGCA 2 cut(s) 197, 266
Hsp92II CATG 1 cut(s) 69
HspAI GCGC 1 cut(s) 97
LmnI GCTCC 1 cut(s) 17
LpnPI CCDG 1 cut(s) 28
LweI GCATC 1 cut(s) 184
MaeIII GTNAC 1 cut(s) 187
MboII GAAGA 1 cut(s) 230
MluCI AATT 1 cut(s) 132
MmeI TCCRAC 2 cut(s) 193, 229
MnlI CCTC 4 cut(s) 36, 64, 115, 238
MseI TTAA 1 cut(s) 81
MspCI CTTAAG 1 cut(s) 80
MspI CCGG 1 cut(s) 15
NlaIII CATG 1 cut(s) 69
PfeI GAWTC 1 cut(s) 29
PkrI GCNGC 1 cut(s) 268
SaqAI TTAA 1 cut(s) 81
SatI GCNGC 1 cut(s) 267
SetI ASST 7 cut(s) 14, 47, 81, 211, 232, 249, 271
SfaNI GCATC 1 cut(s) 184
SgeI CNNG 7 cut(s) 27, 78, 106, 139, 181, 187, 210
SmlI CTYRAG 1 cut(s) 80
SmoI CTYRAG 1 cut(s) 80
Sse9I AATT 1 cut(s) 132
SsiI CCGC 1 cut(s) 155
TasI AATT 1 cut(s) 132
TfiI GAWTC 1 cut(s) 29
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TscAI CASTG 1 cut(s) 55
TseI GCWGC 1 cut(s) 266
TspDTI ATGAA 1 cut(s) 75
TspRI CASTG 1 cut(s) 55
Vha464I CTTAAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.