Rmu_sc0005782.1_g000003
MYB Family

At2g29880-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005782.1
OG0000329
Physical Location & Seq
Forward (+)
9939 .. 10735
797 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005782.1_g000003.1.cds

Sequence Viewer

Length: 621 bp
atgcgtcatagctccggctttgggtgggaccccatcatgaagagaatcactgctagtgatgaagtatgggaagatcacttcaaggcacacccaaaacatagaagccttcgcaaccagactttcatagactatgaggatttgaaaattgcggtgggaaacggaattgcaacaggaaagttttcaattagcctgggcgatgatactgatgcaaccacatacatggttgagcaaagtgaaagtggtcctttgaatgacttgggcacaaatgtgggagttcctaataacaatgtggaaaagaatactggaagtagtgcaacaggaaaacgcaacaagaatgagtttgagagaaataatagcttgattgatgatatttctgaagctgatgttaggaaaagcattggttccattgccaccaatttcaacaaaatgtataacctaatggagaaaagagaatcaagggatacggaatgctggaatgatattaaggacactccaggcttgaatgatgaaacacgttacttggctcttgagttgctcaatactaaagcattgaaggatgtttttctgaaaatgaccccggaggagcgatttaagtggattggattcaagacaatgcaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

206

Amino Acids

23.42

Weight (kDa)

5.48

Isoelectric Point (pI)

32.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000329)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g00551 FvH4_2g33311 FvH4_4g17330 FvH4_5g24690 FvH4_6g24700
rosa_chinensis RchiOBHm_Chr3g0476481 RchiOBHm_Chr3g0497311 RchiOBHm_Chr4g0395221 RchiOBHm_Chr4g0409291 RchiOBHm_Chr5g0019361 RchiOBHm_Chr5g0052631 RchiOBHm_Chr6g0281401 RchiOBHm_Chr6g0297421 RchiOBHm_Chr7g0220391 RchiOBHm_Chr7g0237991
rosa_laevigata RLG00000000925 RLG00000001165 RLG00000001356 RLG00000001477 RLG00000002205 RLG00000002538 RLG00000003099 RLG00000003549 RLG00000003988 RLG00000008622 RLG00000008839 RLG00000010965 RLG00000011510 RLG00000012037 RLG00000013215 RLG00000013450 RLG00000015007 RLG00000017503 RLG00000019169 RLG00000019298 RLG00000020522 RLG00000021241 RLG00000021700 RLG00000022934 RLG00000022935 RLG00000023200 RLG00000026869 RLG00000028902 RLG00000030978 RLG00000032525 RLG00000033761 RLG00000034460 RLG00000034510 RLG00000034626 RLG00000035597 RLG00000035815 RLG00000036785 RLG00000037002
rosa_multiflora Rmu_sc0000147.1_g000040 Rmu_sc0000429.1_g000095 Rmu_sc0002357.1_g000041 Rmu_sc0003113.1_g000004 Rmu_sc0003426.1_g000006 Rmu_sc0004453.1_g000001 Rmu_sc0004455.1_g000005 Rmu_sc0004511.1_g000002 Rmu_sc0005782.1_g000003 Rmu_sc0007848.1_g000030 Rmu_sc0007863.1_g000005 Rmu_sc0008256.1_g000001 Rmu_sc0011325.1_g000005 Rmu_sc0012624.1_g000004 Rmu_sc0017974.1_g000002 Rmu_sc0018061.1_g000001 Rmu_ssc0000366.1_g000011 Rmu_ssc0000472.1_g000025
rosa_roxburghii Rroxscaffold_1G00010100 Rroxscaffold_1G00031270 Rroxscaffold_2G00108870 Rroxscaffold_2G00131670 Rroxscaffold_2G00142200 Rroxscaffold_3G00233060 Rroxscaffold_3G00233710 Rroxscaffold_4G00300200 Rroxscaffold_4G00318490 Rroxscaffold_4G00319390 Rroxscaffold_5G00340520 Rroxscaffold_5G00349510 Rroxscaffold_5G00374060 Rroxscaffold_6G00393340 Rroxscaffold_6G00405620 Rroxscaffold_6G00411840 Rroxscaffold_7G00187660
rosa_rugosa Rorug01G0090600 Rorug01G0091800 Rorug01G0168700 Rorug01G0192800 Rorug02G0326300 Rorug02G0353900 Rorug02G0354000 Rorug02G0408500 Rorug03G0151400 Rorug05G0150800 Rorug05G0150900 Rorug05G0407400 Rorug06G0111000
rosa_samantha Rh3DG370900
rosa_wichuraiana Rw1G001900 Rw2G022570 Rw3G020950 Rw3G028020 Rw4G009960 Rw5G032340 Rw6G003630 Rw6G018060 Rw7G024540 Rw7G035380

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 149
AcuI CTGAAG 1 cut(s) 396
AfiI CCNNNNNNNGG 1 cut(s) 21
AflIII ACRYGT 1 cut(s) 512
AgsI TTSAA 8 cut(s) 82, 142, 183, 250, 421, 502, 553, 607
AjnI CCWGG 2 cut(s) 189, 493
AleI CACNNNNGTG 1 cut(s) 266
AluBI AGCT 3 cut(s) 12, 357, 380
AluI AGCT 3 cut(s) 12, 357, 380
Asp700I GAANNNNTTC 1 cut(s) 178
AspS9I GGNCC 2 cut(s) 28, 242
AsuC2I CCSGG 1 cut(s) 578
AvaII GGWCC 2 cut(s) 28, 242
BaeGI GKGCMC 1 cut(s) 263
BccI CCATC 1 cut(s) 41
BciT130I CCWGG 2 cut(s) 191, 495
BciVI GTATCC 1 cut(s) 454
BcnI CCSGG 1 cut(s) 578
BfaI CTAG 1 cut(s) 54
BfuI GTATCC 1 cut(s) 454
Bme1390I CCNGG 3 cut(s) 191, 495, 578
Bme18I GGWCC 2 cut(s) 28, 242
BmgT120I GGNCC 2 cut(s) 28, 242
BmiI GGNNCC 3 cut(s) 29, 30, 403
BmrFI CCNGG 3 cut(s) 191, 495, 578
BmsI GCATC 1 cut(s) 196
BpmI CTGGAG 1 cut(s) 477
BpuEI CTTGAG 1 cut(s) 548
BpuMI CCSGG 1 cut(s) 578
BsaJI CCNNGG 2 cut(s) 190, 576
Bsc4I CCNNNNNNNGG 1 cut(s) 21
Bse1I ACTGG 1 cut(s) 307
Bse3DI GCAATG 1 cut(s) 405
BseBI CCWGG 2 cut(s) 191, 495
BseDI CCNNGG 2 cut(s) 190, 576
BseGI GGATG 1 cut(s) 562
BseLI CCNNNNNNNGG 1 cut(s) 21
BseMI GCAATG 1 cut(s) 405
BseNI ACTGG 1 cut(s) 307
BseRI GAGGAG 1 cut(s) 596
BseSI GKGCMC 1 cut(s) 263
BsiSI CCGG 2 cut(s) 15, 578
BslFI GGGAC 1 cut(s) 41
BslI CCNNNNNNNGG 1 cut(s) 21
BsmFI GGGAC 1 cut(s) 41
BsmI GAATGC 1 cut(s) 473
Bsp1286I GDGCHC 1 cut(s) 263
Bsp143I GATC 1 cut(s) 73
BspACI CCGC 1 cut(s) 149
BspHI TCATGA 1 cut(s) 36
BspLI GGNNCC 3 cut(s) 29, 30, 403
BsrDI GCAATG 1 cut(s) 405
BsrI ACTGG 1 cut(s) 307
BssECI CCNNGG 2 cut(s) 190, 576
BssMI GATC 1 cut(s) 73
Bst2UI CCWGG 2 cut(s) 191, 495
Bst6I CTCTTC 1 cut(s) 35
BstF5I GGATG 1 cut(s) 562
BstKTI GATC 1 cut(s) 76
BstMBI GATC 1 cut(s) 73
BstNI CCWGG 2 cut(s) 191, 495
BstSCI CCNGG 3 cut(s) 189, 493, 576
BstSLI GKGCMC 1 cut(s) 263
BstXI CCANNNNNNTGG 1 cut(s) 220
BsuI GTATCC 1 cut(s) 454
BtgZI GCGATG 1 cut(s) 210
BtsCI GGATG 1 cut(s) 562
BtsI GCAGTG 1 cut(s) 48
BtsIMutI CAGTG 1 cut(s) 48
CciI TCATGA 1 cut(s) 36
Cfr13I GGNCC 2 cut(s) 28, 242
CviAII CATG 2 cut(s) 37, 220
CviJI RGCY 8 cut(s) 12, 18, 105, 189, 357, 380, 498, 524
CviKI_1 RGCY 8 cut(s) 12, 18, 105, 189, 357, 380, 498, 524
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
Eam1104I CTCTTC 1 cut(s) 35
EarI CTCTTC 1 cut(s) 35
Eco47I GGWCC 2 cut(s) 28, 242
Eco57I CTGAAG 1 cut(s) 396
EcoO109I RGGNCCY 1 cut(s) 28
EcoRII CCWGG 2 cut(s) 189, 493
FaeI CATG 2 cut(s) 40, 223
FaiI YATR 9 cut(s) 9, 38, 67, 99, 125, 132, 217, 221, 432
FalI AAGNNNNNCTT 2 cut(s) 229, 261
FaqI GGGAC 1 cut(s) 41
FatI CATG 2 cut(s) 36, 219
FokI GGATG 1 cut(s) 569
FspBI CTAG 1 cut(s) 54
GsuI CTGGAG 1 cut(s) 477
HapII CCGG 2 cut(s) 15, 578
Hin1II CATG 2 cut(s) 40, 223
HinfI GANTC 3 cut(s) 45, 452, 603
HpaII CCGG 2 cut(s) 15, 578
Hpy188I TCNGA 2 cut(s) 376, 567
Hpy188III TCNNGA 3 cut(s) 37, 527, 607
HpyAV CCTTC 2 cut(s) 116, 547
HpyCH4IV ACGT 1 cut(s) 514
HpyCH4V TGCA 4 cut(s) 167, 209, 314, 616
HpySE526I ACGT 1 cut(s) 514
Hsp92II CATG 2 cut(s) 40, 223
KflI GGGWCCC 1 cut(s) 28
Kzo9I GATC 1 cut(s) 73
LmnI GCTCC 2 cut(s) 17, 583
LweI GCATC 1 cut(s) 196
MaeI CTAG 1 cut(s) 54
MaeII ACGT 1 cut(s) 514
MaeIII GTNAC 1 cut(s) 515
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MboII GAAGA 2 cut(s) 52, 83
MhlI GDGCHC 1 cut(s) 263
MluCI AATT 4 cut(s) 144, 162, 183, 415
MnlI CCTC 2 cut(s) 127, 574
MroXI GAANNNNTTC 1 cut(s) 178
MseI TTAA 2 cut(s) 483, 591
MslI CAYNNNNRTG 2 cut(s) 218, 266
MspI CCGG 2 cut(s) 15, 578
MspR9I CCNGG 3 cut(s) 191, 495, 578
Mva1269I GAATGC 1 cut(s) 473
MvaI CCWGG 2 cut(s) 191, 495
NciI CCSGG 1 cut(s) 578
NdeII GATC 1 cut(s) 73
NlaIII CATG 2 cut(s) 40, 223
NlaIV GGNNCC 3 cut(s) 29, 30, 403
OliI CACNNNNGTG 1 cut(s) 266
PagI TCATGA 1 cut(s) 36
PctI GAATGC 1 cut(s) 473
PdmI GAANNNNTTC 1 cut(s) 178
PfeI GAWTC 3 cut(s) 45, 452, 603
PpuMI RGGWCCY 1 cut(s) 28
Psp5II RGGWCCY 1 cut(s) 28
Psp6I CCWGG 2 cut(s) 189, 493
PspGI CCWGG 2 cut(s) 189, 493
PspN4I GGNNCC 3 cut(s) 29, 30, 403
PspPI GGNCC 2 cut(s) 28, 242
PspPPI RGGWCCY 1 cut(s) 28
RseI CAYNNNNRTG 2 cut(s) 218, 266
SaqAI TTAA 2 cut(s) 483, 591
Sau3AI GATC 1 cut(s) 73
Sau96I GGNCC 2 cut(s) 28, 242
ScrFI CCNGG 3 cut(s) 191, 495, 578
SduI GDGCHC 1 cut(s) 263
SetI ASST 5 cut(s) 14, 359, 382, 438, 517
SfaNI GCATC 1 cut(s) 196
SinI GGWCC 2 cut(s) 28, 242
SmiMI CAYNNNNRTG 2 cut(s) 218, 266
SmlI CTYRAG 1 cut(s) 527
SmoI CTYRAG 1 cut(s) 527
Sse9I AATT 4 cut(s) 144, 162, 183, 415
SsiI CCGC 1 cut(s) 149
SspMI CTAG 1 cut(s) 54
StyD4I CCNGG 3 cut(s) 189, 493, 576
TaiI ACGT 1 cut(s) 517
TasI AATT 4 cut(s) 144, 162, 183, 415
TfiI GAWTC 3 cut(s) 45, 452, 603
Tru1I TTAA 2 cut(s) 483, 591
Tru9I TTAA 2 cut(s) 483, 591
TscAI CASTG 1 cut(s) 55
TspDTI ATGAA 4 cut(s) 53, 75, 112, 522
TspGWI ACGGA 2 cut(s) 174, 479
TspRI CASTG 1 cut(s) 55
VpaK11BI GGWCC 2 cut(s) 28, 242
XmnI GAANNNNTTC 1 cut(s) 178
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.