Rmu_co8416715.1_g000001

source UniProtKB

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8416715.1
OG0000321
Physical Location & Seq
Forward (+)
91 .. 1237
1147 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8416715.1_g000001.1.cds

Sequence Viewer

Length: 894 bp
atggagcaaatgcagaaccagcttttaatgtttactcaattgctacaacctgatcaattgttaatgatgcaacacatggtccaaggtagtcgtgtgtctgagaaatctagttgctcagttcagaaggacaaagatgagacattatctaaggaggaggagtctagggtggaaatgatgaaacaaaaagagaagaagtctaagaaagctacatttaaagtcaatgtacaagaggctttgaagactagtactaaaattccagaacaaatcgagcaggtaaaacaacacaataaagaagaatcagctctgaaacctggaaaaaacaaacaagatggctatacagaggttcccaaagacaagccacaagatattgaaaagtcaaagaagtgcaagttagctgtggggaatatcaacaatgttgttgcaatgggaatggtgattctgttagatggaccaattcatggagtgccattaggggatggtaacgtacgagtttctgttgaagtacctattaagggtgaggctctcctgccaatacctattggcgatgaaattgtgactcttagacaagcaattgggactcatgtggcttggcctcgtaatcttgttatagtgaccaatgaaaagcccaagctaaagactccaaatgcatcatttaaacccatgttgccacaaaacttgtacaagatgcctctatctgtacgatttctattgcgatttgctaggacaatgcgagaagaaaaaccattgaaggtggccattgattctggtgtctttggatatgaacaagaaacttaccttaacaaagatgacatcattgaattttgttcaatggaaccactctctactgtttgcatgacaatctacatgaggttaggctataaccatgatttttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_C48 Transposase_24

Protein Analysis

297

Amino Acids

33.73

Weight (kDa)

8.82

Isoelectric Point (pI)

40.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000321)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221
prunus_persica Prupe.6G157700_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1
pyrus_communis pycom03g09490 pycom03g19580 pycom07g21940 pycom07g27440 pycom14g09710
rosa_chinensis RchiOBHm_Chr1g0318231 RchiOBHm_Chr1g0318241 RchiOBHm_Chr1g0325001 RchiOBHm_Chr1g0325021 RchiOBHm_Chr2g0112301 RchiOBHm_Chr3g0482281 RchiOBHm_Chr3g0482291 RchiOBHm_Chr4g0390561 RchiOBHm_Chr4g0390571 RchiOBHm_Chr4g0417951 RchiOBHm_Chr7g0232611 RchiOBHm_Chr7g0240601
rosa_laevigata RLG00000001069 RLG00000013674 RLG00000018830 RLG00000020747
rosa_multiflora Rmu_co8364947.1_g000001 Rmu_co8416715.1_g000001 Rmu_sc0001348.1_g000014 Rmu_sc0002986.1_g000026 Rmu_sc0004003.1_g000007 Rmu_sc0005137.1_g000014 Rmu_sc0006583.1_g000016
rosa_roxburghii Rroxscaffold_159G00432800 Rroxscaffold_174G00435170 Rroxscaffold_1G00001870 Rroxscaffold_1G00044480 Rroxscaffold_2G00111880 Rroxscaffold_2G00111890 Rroxscaffold_2G00119670 Rroxscaffold_2G00129450 Rroxscaffold_2G00131520 Rroxscaffold_3G00240880 Rroxscaffold_5G00337440 Rroxscaffold_5G00356220 Rroxscaffold_5G00362390 Rroxscaffold_5G00368260 Rroxscaffold_7G00196230 Rroxscaffold_7G00196240 Rroxscaffold_7G00202020
rosa_rugosa Rorug01G0094700 Rorug02G0050500 Rorug02G0179800 Rorug05G0042800 Rorug05G0043000 Rorug05G0043100 Rorug05G0043200 Rorug06G0045300 Rorug06G0045600 Rorug06G0069400 Rorug07G0213000 Rorug07G0213000
rosa_samantha Rh1AG031600 Rh1DG131700 Rh1DG134800 Rh1DG288000 Rh1DG288100 Rh2AG218500 Rh2AG232500 Rh2BG245900 Rh2CG236700 Rh2DG224300 Rh2DG224400 Rh2DG240200 Rh3AG247300 Rh3BG126600 Rh3BG126700 Rh3BG333600 Rh5AG440500 Rh5AG440600 Rh5BG457800 Rh5DG472700 Rh5DG472800 Rh6BG138000 Rh6BG138100 Rh6BG171500 Rh6BG188400 Rh6BG230000 Rh6CG135600 Rh6CG135700 Rh6CG186300 Rh6CG450300 Rh7AG376100 Rh7CG394800 Rh7CG426100 Rh7CG426200 Rh7DG247700 Rh7DG322600 Rh7DG334300 Rh7DG364700
rosa_wichuraiana Rw2G018040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 262
AccB7I CCANNNNNTGG 1 cut(s) 458
AcoI YGGCCR 1 cut(s) 753
AcsI RAATTY 2 cut(s) 252, 818
AfaI GTAC 6 cut(s) 225, 247, 486, 504, 680, 699
AfiI CCNNNNNNNGG 2 cut(s) 458, 512
AgsI TTSAA 6 cut(s) 238, 371, 500, 748, 818, 828
AhlI ACTAGT 1 cut(s) 242
AjnI CCWGG 1 cut(s) 310
AluBI AGCT 5 cut(s) 22, 206, 302, 395, 631
AluI AGCT 5 cut(s) 22, 206, 302, 395, 631
Alw26I GTCTC 1 cut(s) 131
AoxI GGCC 2 cut(s) 590, 753
ApoI RAATTY 2 cut(s) 252, 818
AspS9I GGNCC 2 cut(s) 79, 449
AsuHPI GGTGA 2 cut(s) 445, 527
AvaII GGWCC 2 cut(s) 79, 449
BalI TGGCCA 1 cut(s) 755
BbsI GAAGAC 1 cut(s) 245
BccI CCATC 3 cut(s) 323, 440, 470
BciT130I CCWGG 1 cut(s) 312
BclI TGATCA 1 cut(s) 52
BcoDI GTCTC 1 cut(s) 131
BcuI ACTAGT 1 cut(s) 242
BfaI CTAG 4 cut(s) 108, 162, 243, 720
BfuAI ACCTGC 1 cut(s) 262
BmcAI AGTACT 1 cut(s) 247
Bme1390I CCNGG 1 cut(s) 312
Bme18I GGWCC 2 cut(s) 79, 449
BmgT120I GGNCC 2 cut(s) 79, 449
BmiI GGNNCC 2 cut(s) 345, 834
BmrFI CCNGG 1 cut(s) 312
BmsI GCATC 3 cut(s) 57, 656, 675
BpiI GAAGAC 1 cut(s) 245
BsaJI CCNNGG 1 cut(s) 82
BsaXI ACNNNNNCTCC 2 cut(s) 143, 173
Bsc4I CCNNNNNNNGG 2 cut(s) 458, 512
Bse3DI GCAATG 1 cut(s) 429
BseBI CCWGG 1 cut(s) 312
BseDI CCNNGG 1 cut(s) 82
BseGI GGATG 1 cut(s) 481
BseLI CCNNNNNNNGG 2 cut(s) 458, 512
BseMI GCAATG 1 cut(s) 429
BseMII CTCAG 2 cut(s) 90, 129
BseRI GAGGAG 2 cut(s) 167, 170
BshFI GGCC 2 cut(s) 592, 755
BsiWI CGTACG 1 cut(s) 484
BslFI GGGAC 1 cut(s) 589
BslI CCNNNNNNNGG 2 cut(s) 458, 512
BsmAI GTCTC 1 cut(s) 131
BsmFI GGGAC 1 cut(s) 589
BsnI GGCC 2 cut(s) 592, 755
Bsp1407I TGTACA 2 cut(s) 223, 678
Bsp143I GATC 1 cut(s) 52
BspANI GGCC 2 cut(s) 592, 755
BspCNI CTCAG 2 cut(s) 91, 128
BspLI GGNNCC 2 cut(s) 345, 834
BspMI ACCTGC 1 cut(s) 262
BsrDI GCAATG 1 cut(s) 429
BsrGI TGTACA 2 cut(s) 223, 678
BssECI CCNNGG 1 cut(s) 82
BssMI GATC 1 cut(s) 52
BssT1I CCWWGG 1 cut(s) 82
Bst2UI CCWGG 1 cut(s) 312
Bst4CI ACNGT 1 cut(s) 847
BstAUI TGTACA 2 cut(s) 223, 678
BstDEI CTNAG 5 cut(s) 99, 115, 147, 198, 560
BstF5I GGATG 1 cut(s) 481
BstKTI GATC 1 cut(s) 55
BstMAI GTCTC 1 cut(s) 131
BstMBI GATC 1 cut(s) 52
BstMWI GCNNNNNNNGC 1 cut(s) 19
BstNI CCWGG 1 cut(s) 312
BstSCI CCNGG 1 cut(s) 310
BstV2I GAAGAC 1 cut(s) 245
BsuRI GGCC 2 cut(s) 592, 755
BtgZI GCGATG 1 cut(s) 558
BtsCI GGATG 1 cut(s) 481
BveI ACCTGC 1 cut(s) 262
Cfr13I GGNCC 2 cut(s) 79, 449
Csp6I GTAC 6 cut(s) 224, 246, 485, 503, 679, 698
CspCI CAANNNNNGTGG 2 cut(s) 657, 692
CviAII CATG 7 cut(s) 76, 458, 581, 661, 853, 865, 884
CviQI GTAC 6 cut(s) 224, 246, 485, 503, 679, 698
DdeI CTNAG 5 cut(s) 99, 115, 147, 198, 560
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
DraI TTTAAA 2 cut(s) 214, 655
EaeI YGGCCR 1 cut(s) 753
Eco130I CCWWGG 1 cut(s) 82
Eco47I GGWCC 2 cut(s) 79, 449
EcoRII CCWGG 1 cut(s) 310
EcoT14I CCWWGG 1 cut(s) 82
EcoT22I ATGCAT 1 cut(s) 649
ErhI CCWWGG 1 cut(s) 82
FaeI CATG 7 cut(s) 79, 461, 584, 664, 856, 868, 887
FaqI GGGAC 1 cut(s) 589
FatI CATG 7 cut(s) 75, 457, 580, 660, 852, 864, 883
FbaI TGATCA 1 cut(s) 52
FokI GGATG 1 cut(s) 488
FspBI CTAG 4 cut(s) 108, 162, 243, 720
HaeIII GGCC 2 cut(s) 592, 755
Hin1II CATG 7 cut(s) 79, 461, 584, 664, 856, 868, 887
HinfI GANTC 7 cut(s) 158, 296, 436, 556, 577, 637, 761
HphI GGTGA 2 cut(s) 445, 527
Hpy166II GTNNAC 1 cut(s) 33
Hpy188I TCNGA 3 cut(s) 100, 123, 306
Hpy188III TCNNGA 1 cut(s) 257
Hpy8I GTNNAC 1 cut(s) 33
HpyAV CCTTC 2 cut(s) 118, 742
HpyCH4III ACNGT 1 cut(s) 847
HpyCH4IV ACGT 1 cut(s) 483
HpyCH4V TGCA 6 cut(s) 13, 70, 387, 422, 647, 852
HpyF10VI GCNNNNNNNGC 1 cut(s) 19
HpyF3I CTNAG 5 cut(s) 99, 115, 147, 198, 560
HpySE526I ACGT 1 cut(s) 483
Hsp92II CATG 7 cut(s) 79, 461, 584, 664, 856, 868, 887
Ksp22I TGATCA 1 cut(s) 52
Kzo9I GATC 1 cut(s) 52
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 8 cut(s) 32, 63, 257, 270, 297, 324, 539, 750
LweI GCATC 3 cut(s) 57, 656, 675
MaeI CTAG 4 cut(s) 108, 162, 243, 720
MaeII ACGT 1 cut(s) 483
MaeIII GTNAC 3 cut(s) 479, 553, 610
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MboII GAAGA 4 cut(s) 202, 250, 305, 746
MfeI CAATTG 3 cut(s) 38, 56, 570
MlsI TGGCCA 1 cut(s) 755
MluCI AATT 7 cut(s) 38, 56, 252, 453, 549, 570, 818
MluNI TGGCCA 1 cut(s) 755
MlyI GAGTC 4 cut(s) 167, 550, 571, 631
MnlI CCTC 8 cut(s) 145, 148, 223, 334, 511, 603, 699, 861
Mox20I TGGCCA 1 cut(s) 755
Mph1103I ATGCAT 1 cut(s) 649
MscI TGGCCA 1 cut(s) 755
MseI TTAA 7 cut(s) 26, 62, 213, 510, 654, 798, 892
Msp20I TGGCCA 1 cut(s) 755
MspR9I CCNGG 1 cut(s) 312
MunI CAATTG 3 cut(s) 38, 56, 570
MvaI CCWGG 1 cut(s) 312
MwoI GCNNNNNNNGC 1 cut(s) 19
NdeII GATC 1 cut(s) 52
NlaIII CATG 7 cut(s) 79, 461, 584, 664, 856, 868, 887
NlaIV GGNNCC 2 cut(s) 345, 834
NmuCI GTSAC 2 cut(s) 553, 610
NsiI ATGCAT 1 cut(s) 649
PfeI GAWTC 3 cut(s) 296, 436, 761
Pfl23II CGTACG 1 cut(s) 484
PflMI CCANNNNNTGG 1 cut(s) 458
PleI GAGTC 4 cut(s) 166, 550, 571, 631
PpsI GAGTC 4 cut(s) 166, 550, 571, 631
Psp6I CCWGG 1 cut(s) 310
PspGI CCWGG 1 cut(s) 310
PspLI CGTACG 1 cut(s) 484
PspN4I GGNNCC 2 cut(s) 345, 834
PspPI GGNCC 2 cut(s) 79, 449
RsaI GTAC 6 cut(s) 225, 247, 486, 504, 680, 699
RsaNI GTAC 6 cut(s) 224, 246, 485, 503, 679, 698
SaqAI TTAA 7 cut(s) 26, 62, 213, 510, 654, 798, 892
Sau3AI GATC 1 cut(s) 52
Sau96I GGNCC 2 cut(s) 79, 449
ScaI AGTACT 1 cut(s) 247
SchI GAGTC 4 cut(s) 167, 550, 571, 631
ScrFI CCNGG 1 cut(s) 312
SfaNI GCATC 3 cut(s) 57, 656, 675
SinI GGWCC 2 cut(s) 79, 449
SpeI ACTAGT 1 cut(s) 242
Sse9I AATT 7 cut(s) 38, 56, 252, 453, 549, 570, 818
SspMI CTAG 4 cut(s) 108, 162, 243, 720
StyD4I CCNGG 1 cut(s) 310
StyI CCWWGG 1 cut(s) 82
TaaI ACNGT 1 cut(s) 847
TaiI ACGT 1 cut(s) 486
TaqI TCGA 1 cut(s) 267
TasI AATT 7 cut(s) 38, 56, 252, 453, 549, 570, 818
TatI WGTACW 3 cut(s) 223, 245, 678
TfiI GAWTC 3 cut(s) 296, 436, 761
Tru1I TTAA 7 cut(s) 26, 62, 213, 510, 654, 798, 892
Tru9I TTAA 7 cut(s) 26, 62, 213, 510, 654, 798, 892
TseFI GTSAC 2 cut(s) 553, 610
Tsp45I GTSAC 2 cut(s) 553, 610
TspDTI ATGAA 5 cut(s) 191, 446, 561, 633, 795
Van91I CCANNNNNTGG 1 cut(s) 458
VpaK11BI GGWCC 2 cut(s) 79, 449
XapI RAATTY 2 cut(s) 252, 818
XspI CTAG 4 cut(s) 108, 162, 243, 720
ZrmI AGTACT 1 cut(s) 247
Zsp2I ATGCAT 1 cut(s) 649
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.