Rh6CG450300

source UniProtKB

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0000321
Physical Location & Seq
Forward (+)
62755452 .. 62756401
950 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG450300.1

Sequence Viewer

Length: 435 bp
ATGGTAGGAGTAAAGGCTCGAATAGAAGTGACATATAACAAAAAGGGGCAACCAATTGGTCTTGGAGGGAAGAGGCTAGCTATTTTTATTGGGGTAATGGCTCGAACTACTATCCCAATCACATATGAGACTTGGCCAGCCGTCAAGAATCCACTTAAAGAAATGATATGGAGTATGGTTCAGGAAATTCATGAGGACCACTCAAGGAGACGAGCTTTTCATGAGTATGATCATCGAATGTCCAGGAAAGGCTATGCTAATTTGGAAGAGGAACTAAAACTGGAGTTAGGAACTGAAGAAGATATTGACAGAGCTATATTATGGAAGAAAGGGCGTGTCGATAAAGAGGGTAACTATTTGAGTGAGACAACCAAACAGCGTGTTGAGAAAATTGTGAGTTCAGATTTATCGGACCTTAATCACCTTAAATATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_C48 Transposase_24

Protein Analysis

144

Amino Acids

16.77

Weight (kDa)

9.05

Isoelectric Point (pI)

46.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000321)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221
prunus_persica Prupe.6G157700_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1
pyrus_communis pycom03g09490 pycom03g19580 pycom07g21940 pycom07g27440 pycom14g09710
rosa_chinensis RchiOBHm_Chr1g0318231 RchiOBHm_Chr1g0318241 RchiOBHm_Chr1g0325001 RchiOBHm_Chr1g0325021 RchiOBHm_Chr2g0112301 RchiOBHm_Chr3g0482281 RchiOBHm_Chr3g0482291 RchiOBHm_Chr4g0390561 RchiOBHm_Chr4g0390571 RchiOBHm_Chr4g0417951 RchiOBHm_Chr7g0232611 RchiOBHm_Chr7g0240601
rosa_laevigata RLG00000001069 RLG00000013674 RLG00000018830 RLG00000020747
rosa_multiflora Rmu_co8364947.1_g000001 Rmu_co8416715.1_g000001 Rmu_sc0001348.1_g000014 Rmu_sc0002986.1_g000026 Rmu_sc0004003.1_g000007 Rmu_sc0005137.1_g000014 Rmu_sc0006583.1_g000016
rosa_roxburghii Rroxscaffold_159G00432800 Rroxscaffold_174G00435170 Rroxscaffold_1G00001870 Rroxscaffold_1G00044480 Rroxscaffold_2G00111880 Rroxscaffold_2G00111890 Rroxscaffold_2G00119670 Rroxscaffold_2G00129450 Rroxscaffold_2G00131520 Rroxscaffold_3G00240880 Rroxscaffold_5G00337440 Rroxscaffold_5G00356220 Rroxscaffold_5G00362390 Rroxscaffold_5G00368260 Rroxscaffold_7G00196230 Rroxscaffold_7G00196240 Rroxscaffold_7G00202020
rosa_rugosa Rorug01G0094700 Rorug02G0050500 Rorug02G0179800 Rorug05G0042800 Rorug05G0043000 Rorug05G0043100 Rorug05G0043200 Rorug06G0045300 Rorug06G0045600 Rorug06G0069400 Rorug07G0213000 Rorug07G0213000
rosa_samantha Rh1AG031600 Rh1DG131700 Rh1DG134800 Rh1DG288000 Rh1DG288100 Rh2AG218500 Rh2AG232500 Rh2BG245900 Rh2CG236700 Rh2DG224300 Rh2DG224400 Rh2DG240200 Rh3AG247300 Rh3BG126600 Rh3BG126700 Rh3BG333600 Rh5AG440500 Rh5AG440600 Rh5BG457800 Rh5DG472700 Rh5DG472800 Rh6BG138000 Rh6BG138100 Rh6BG171500 Rh6BG188400 Rh6BG230000 Rh6CG135600 Rh6CG135700 Rh6CG186300 Rh6CG450300 Rh7AG376100 Rh7CG394800 Rh7CG426100 Rh7CG426200 Rh7DG247700 Rh7DG322600 Rh7DG334300 Rh7DG364700
rosa_wichuraiana Rw2G018040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 134
AcsI RAATTY 1 cut(s) 186
AcuI CTGAAG 1 cut(s) 315
AjnI CCWGG 1 cut(s) 242
AluBI AGCT 3 cut(s) 80, 215, 314
AluI AGCT 3 cut(s) 80, 215, 314
Alw26I GTCTC 3 cut(s) 122, 202, 359
AoxI GGCC 1 cut(s) 134
ApoI RAATTY 1 cut(s) 186
AspS9I GGNCC 2 cut(s) 196, 412
AsuHPI GGTGA 1 cut(s) 413
AsuNHI GCTAGC 1 cut(s) 76
AvaII GGWCC 2 cut(s) 196, 412
BalI TGGCCA 1 cut(s) 136
BceAI ACGGC 1 cut(s) 125
BciT130I CCWGG 1 cut(s) 244
BclI TGATCA 1 cut(s) 229
BcoDI GTCTC 3 cut(s) 122, 202, 359
BfaI CTAG 1 cut(s) 77
Bme1390I CCNGG 1 cut(s) 244
Bme18I GGWCC 2 cut(s) 196, 412
BmgT120I GGNCC 2 cut(s) 196, 412
BmrFI CCNGG 1 cut(s) 244
BmtI GCTAGC 1 cut(s) 80
BplI GAGNNNNNCTC 2 cut(s) 185, 217
BpmI CTGGAG 1 cut(s) 302
BpuEI CTTGAG 1 cut(s) 187
Bse1I ACTGG 1 cut(s) 285
BseBI CCWGG 1 cut(s) 244
BseNI ACTGG 1 cut(s) 285
BshFI GGCC 1 cut(s) 136
BsmAI GTCTC 3 cut(s) 122, 202, 359
BsmBI CGTCTC 1 cut(s) 202
BsnI GGCC 1 cut(s) 136
Bsp143I GATC 1 cut(s) 229
BspANI GGCC 1 cut(s) 136
BspHI TCATGA 2 cut(s) 190, 220
BspOI GCTAGC 1 cut(s) 80
BsrI ACTGG 1 cut(s) 285
BssMI GATC 1 cut(s) 229
Bst2UI CCWGG 1 cut(s) 244
Bst6I CTCTTC 2 cut(s) 65, 261
BstC8I GCNNGC 2 cut(s) 78, 138
BstKTI GATC 1 cut(s) 232
BstMAI GTCTC 3 cut(s) 122, 202, 359
BstMBI GATC 1 cut(s) 229
BstNI CCWGG 1 cut(s) 244
BstSCI CCNGG 1 cut(s) 242
BsuRI GGCC 1 cut(s) 136
Cac8I GCNNGC 2 cut(s) 78, 138
CciI TCATGA 2 cut(s) 190, 220
Cfr13I GGNCC 2 cut(s) 196, 412
CviAII CATG 2 cut(s) 191, 221
CviJI RGCY 9 cut(s) 17, 76, 80, 101, 136, 140, 215, 252, 314
CviKI_1 RGCY 9 cut(s) 17, 76, 80, 101, 136, 140, 215, 252, 314
DpnI GATC 1 cut(s) 231
DpnII GATC 1 cut(s) 229
EaeI YGGCCR 1 cut(s) 134
Eam1104I CTCTTC 2 cut(s) 65, 261
EarI CTCTTC 2 cut(s) 65, 261
Eco47I GGWCC 2 cut(s) 196, 412
Eco57I CTGAAG 1 cut(s) 315
EcoRII CCWGG 1 cut(s) 242
Esp3I CGTCTC 1 cut(s) 202
FaeI CATG 2 cut(s) 194, 224
FatI CATG 2 cut(s) 190, 220
FauNDI CATATG 1 cut(s) 124
FbaI TGATCA 1 cut(s) 229
FspBI CTAG 1 cut(s) 77
GsuI CTGGAG 1 cut(s) 302
HaeIII GGCC 1 cut(s) 136
Hin1II CATG 2 cut(s) 194, 224
HinfI GANTC 1 cut(s) 148
HphI GGTGA 1 cut(s) 413
Hpy188I TCNGA 2 cut(s) 403, 412
Hpy188III TCNNGA 4 cut(s) 145, 182, 191, 221
Hsp92II CATG 2 cut(s) 194, 224
Ksp22I TGATCA 1 cut(s) 229
Kzo9I GATC 1 cut(s) 229
LpnPI CCDG 5 cut(s) 150, 167, 229, 256, 266
MaeI CTAG 1 cut(s) 77
MaeIII GTNAC 2 cut(s) 28, 350
MalI GATC 1 cut(s) 231
MboI GATC 1 cut(s) 229
MboII GAAGA 5 cut(s) 82, 278, 308, 311, 337
MfeI CAATTG 1 cut(s) 54
MlsI TGGCCA 1 cut(s) 136
MluCI AATT 4 cut(s) 54, 186, 259, 390
MluNI TGGCCA 1 cut(s) 136
MnlI CCTC 5 cut(s) 59, 66, 187, 262, 340
Mox20I TGGCCA 1 cut(s) 136
MscI TGGCCA 1 cut(s) 136
MseI TTAA 3 cut(s) 156, 417, 426
MslI CAYNNNNRTG 1 cut(s) 225
Msp20I TGGCCA 1 cut(s) 136
MspR9I CCNGG 1 cut(s) 244
MunI CAATTG 1 cut(s) 54
MvaI CCWGG 1 cut(s) 244
NdeI CATATG 1 cut(s) 124
NdeII GATC 1 cut(s) 229
NheI GCTAGC 1 cut(s) 76
NlaIII CATG 2 cut(s) 194, 224
NmuCI GTSAC 1 cut(s) 28
PagI TCATGA 2 cut(s) 190, 220
PfeI GAWTC 1 cut(s) 148
PfoI TCCNGGA 1 cut(s) 242
Psp6I CCWGG 1 cut(s) 242
PspGI CCWGG 1 cut(s) 242
PspPI GGNCC 2 cut(s) 196, 412
RseI CAYNNNNRTG 1 cut(s) 225
SaqAI TTAA 3 cut(s) 156, 417, 426
Sau3AI GATC 1 cut(s) 229
Sau96I GGNCC 2 cut(s) 196, 412
ScrFI CCNGG 1 cut(s) 244
SetI ASST 5 cut(s) 82, 217, 316, 417, 426
SinI GGWCC 2 cut(s) 196, 412
SmiMI CAYNNNNRTG 1 cut(s) 225
SmlI CTYRAG 1 cut(s) 202
SmoI CTYRAG 1 cut(s) 202
Sse9I AATT 4 cut(s) 54, 186, 259, 390
SspI AATATT 1 cut(s) 431
SspMI CTAG 1 cut(s) 77
StyD4I CCNGG 1 cut(s) 242
TaqI TCGA 4 cut(s) 19, 103, 235, 339
TasI AATT 4 cut(s) 54, 186, 259, 390
TfiI GAWTC 1 cut(s) 148
Tru1I TTAA 3 cut(s) 156, 417, 426
Tru9I TTAA 3 cut(s) 156, 417, 426
TseFI GTSAC 1 cut(s) 28
Tsp45I GTSAC 1 cut(s) 28
TspDTI ATGAA 2 cut(s) 179, 209
VpaK11BI GGWCC 2 cut(s) 196, 412
XapI RAATTY 1 cut(s) 186
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.