Rh7CG426100

source UniProtKB

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0000321
Physical Location & Seq
Reverse (-)
55417204 .. 55418453
1250 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG426100.1

Sequence Viewer

Length: 803 bp
ATGGCTTTGGAAAAGCCTGAATATTCTGGTCGTGTAAGAGGTGTTGGAAGCAATGTCACACCTATTTTGTACTTCAATACTCCAAGGTGTCGATCTCAATCCACCCAAAATCAGTTGTTGCAACAAATGGAGCAAATGCAGAACCAGCTTTTAATGTTTACTCAATTGCTACAACCTGATCAATTGTTAATGATGCAACACATGGTCCAAGGTAGCCGTGTGTCTGAGAAATCTAGTTGCTCAGTTCAGAAGGACAAAGATGAGACATTATCTAAGGAGGAGGAGTCTAGGGTGGAAATGATGAAACAAAAAGAGAAGAAGTCTAAGAAAGCTACATTTAAAGTCAATGTACAAGAGGCTTTGAAGACTAGTACTAAAATTCCAGAACAAATCGAGCAGGTAAAACAACACAATAAAGAAGAATCAGCTCTGAAACCTGGAAAAAACAAACAAGATGGCTATACAGAGGTTCCCAAAGACAAGCCACAAGATATTGAAAAGTCAAAGAAGTGCAAGTTAGCTGTAGGGAATATCAACAATGTTGTTGCAATGGGAATGCCCAAGCTAAAGACTCCAAATGCATCATTTAAACCCATGTTGCCACAAAACTTGTACAAGATGCCTCTATCTATACGATTTCTATTGCGATTTGCTAGGACAATGCGAGAAGAAAAACCATTGATGGTGGCCATTGATTCTGGTGTCTTTGGATATGAACAAGAAACTTACCTTAACAAAGATGACATCATTGAATTTTGGTCGATGGAACCACTCTCTACTGTTTGCATGACAATCTACATGAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_C48 Transposase_24

Protein Analysis

267

Amino Acids

30.79

Weight (kDa)

9.23

Isoelectric Point (pI)

50.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000321)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221
prunus_persica Prupe.6G157700_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1
pyrus_communis pycom03g09490 pycom03g19580 pycom07g21940 pycom07g27440 pycom14g09710
rosa_chinensis RchiOBHm_Chr1g0318231 RchiOBHm_Chr1g0318241 RchiOBHm_Chr1g0325001 RchiOBHm_Chr1g0325021 RchiOBHm_Chr2g0112301 RchiOBHm_Chr3g0482281 RchiOBHm_Chr3g0482291 RchiOBHm_Chr4g0390561 RchiOBHm_Chr4g0390571 RchiOBHm_Chr4g0417951 RchiOBHm_Chr7g0232611 RchiOBHm_Chr7g0240601
rosa_laevigata RLG00000001069 RLG00000013674 RLG00000018830 RLG00000020747
rosa_multiflora Rmu_co8364947.1_g000001 Rmu_co8416715.1_g000001 Rmu_sc0001348.1_g000014 Rmu_sc0002986.1_g000026 Rmu_sc0004003.1_g000007 Rmu_sc0005137.1_g000014 Rmu_sc0006583.1_g000016
rosa_roxburghii Rroxscaffold_159G00432800 Rroxscaffold_174G00435170 Rroxscaffold_1G00001870 Rroxscaffold_1G00044480 Rroxscaffold_2G00111880 Rroxscaffold_2G00111890 Rroxscaffold_2G00119670 Rroxscaffold_2G00129450 Rroxscaffold_2G00131520 Rroxscaffold_3G00240880 Rroxscaffold_5G00337440 Rroxscaffold_5G00356220 Rroxscaffold_5G00362390 Rroxscaffold_5G00368260 Rroxscaffold_7G00196230 Rroxscaffold_7G00196240 Rroxscaffold_7G00202020
rosa_rugosa Rorug01G0094700 Rorug02G0050500 Rorug02G0179800 Rorug05G0042800 Rorug05G0043000 Rorug05G0043100 Rorug05G0043200 Rorug06G0045300 Rorug06G0045600 Rorug06G0069400 Rorug07G0213000 Rorug07G0213000
rosa_samantha Rh1AG031600 Rh1DG131700 Rh1DG134800 Rh1DG288000 Rh1DG288100 Rh2AG218500 Rh2AG232500 Rh2BG245900 Rh2CG236700 Rh2DG224300 Rh2DG224400 Rh2DG240200 Rh3AG247300 Rh3BG126600 Rh3BG126700 Rh3BG333600 Rh5AG440500 Rh5AG440600 Rh5BG457800 Rh5DG472700 Rh5DG472800 Rh6BG138000 Rh6BG138100 Rh6BG171500 Rh6BG188400 Rh6BG230000 Rh6CG135600 Rh6CG135700 Rh6CG186300 Rh6CG450300 Rh7AG376100 Rh7CG394800 Rh7CG426100 Rh7CG426200 Rh7DG247700 Rh7DG322600 Rh7DG334300 Rh7DG364700
rosa_wichuraiana Rw2G018040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 388
AcoI YGGCCR 1 cut(s) 687
AcsI RAATTY 2 cut(s) 378, 752
AfaI GTAC 4 cut(s) 71, 351, 373, 614
AgsI TTSAA 4 cut(s) 76, 364, 497, 752
AhlI ACTAGT 1 cut(s) 368
AjnI CCWGG 1 cut(s) 436
AluBI AGCT 5 cut(s) 148, 332, 428, 521, 565
AluI AGCT 5 cut(s) 148, 332, 428, 521, 565
Alw26I GTCTC 1 cut(s) 257
AoxI GGCC 1 cut(s) 687
ApoI RAATTY 2 cut(s) 378, 752
AspS9I GGNCC 1 cut(s) 205
AvaII GGWCC 1 cut(s) 205
BalI TGGCCA 1 cut(s) 689
BbsI GAAGAC 1 cut(s) 371
BccI CCATC 3 cut(s) 449, 676, 757
BceAI ACGGC 1 cut(s) 201
BciT130I CCWGG 1 cut(s) 438
BclI TGATCA 1 cut(s) 178
BcoDI GTCTC 1 cut(s) 257
BcuI ACTAGT 1 cut(s) 368
BfaI CTAG 4 cut(s) 234, 288, 369, 654
BfmI CTRYAG 1 cut(s) 522
BfuAI ACCTGC 1 cut(s) 388
BmcAI AGTACT 1 cut(s) 373
Bme1390I CCNGG 1 cut(s) 438
Bme18I GGWCC 1 cut(s) 205
BmgT120I GGNCC 1 cut(s) 205
BmiI GGNNCC 2 cut(s) 471, 768
BmrFI CCNGG 1 cut(s) 438
BmsI GCATC 3 cut(s) 183, 590, 609
BpiI GAAGAC 1 cut(s) 371
BsaBI GATNNNNATC 1 cut(s) 97
BsaJI CCNNGG 2 cut(s) 83, 208
BsaXI ACNNNNNCTCC 2 cut(s) 269, 299
Bse3DI GCAATG 2 cut(s) 58, 555
Bse8I GATNNNNATC 1 cut(s) 97
BseBI CCWGG 1 cut(s) 438
BseDI CCNNGG 2 cut(s) 83, 208
BseJI GATNNNNATC 1 cut(s) 97
BseMI GCAATG 2 cut(s) 58, 555
BseMII CTCAG 2 cut(s) 216, 255
BseRI GAGGAG 2 cut(s) 293, 296
BshFI GGCC 1 cut(s) 689
BsmAI GTCTC 1 cut(s) 257
BsmI GAATGC 1 cut(s) 561
BsnI GGCC 1 cut(s) 689
Bsp1407I TGTACA 2 cut(s) 349, 612
Bsp143I GATC 2 cut(s) 92, 178
BspANI GGCC 1 cut(s) 689
BspCNI CTCAG 2 cut(s) 217, 254
BspLI GGNNCC 2 cut(s) 471, 768
BspMI ACCTGC 1 cut(s) 388
BsrDI GCAATG 2 cut(s) 58, 555
BsrGI TGTACA 2 cut(s) 349, 612
BssECI CCNNGG 2 cut(s) 83, 208
BssMI GATC 2 cut(s) 92, 178
BssT1I CCWWGG 2 cut(s) 83, 208
Bst2UI CCWGG 1 cut(s) 438
Bst4CI ACNGT 1 cut(s) 781
BstAUI TGTACA 2 cut(s) 349, 612
BstDEI CTNAG 4 cut(s) 225, 241, 273, 324
BstKTI GATC 2 cut(s) 95, 181
BstMAI GTCTC 1 cut(s) 257
BstMBI GATC 2 cut(s) 92, 178
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstNI CCWGG 1 cut(s) 438
BstSCI CCNGG 1 cut(s) 436
BstSFI CTRYAG 1 cut(s) 522
BstV2I GAAGAC 1 cut(s) 371
BsuRI GGCC 1 cut(s) 689
BveI ACCTGC 1 cut(s) 388
Cfr13I GGNCC 1 cut(s) 205
Csp6I GTAC 4 cut(s) 70, 350, 372, 613
CspCI CAANNNNNGTGG 2 cut(s) 591, 626
CviAII CATG 4 cut(s) 202, 595, 787, 799
CviQI GTAC 4 cut(s) 70, 350, 372, 613
DdeI CTNAG 4 cut(s) 225, 241, 273, 324
DpnI GATC 2 cut(s) 94, 180
DpnII GATC 2 cut(s) 92, 178
DraI TTTAAA 2 cut(s) 340, 589
EaeI YGGCCR 1 cut(s) 687
Eco130I CCWWGG 2 cut(s) 83, 208
Eco47I GGWCC 1 cut(s) 205
EcoRII CCWGG 1 cut(s) 436
EcoT14I CCWWGG 2 cut(s) 83, 208
EcoT22I ATGCAT 1 cut(s) 583
ErhI CCWWGG 2 cut(s) 83, 208
FaeI CATG 4 cut(s) 205, 598, 790, 802
FaiI YATR 7 cut(s) 203, 462, 596, 632, 714, 788, 800
FatI CATG 4 cut(s) 201, 594, 786, 798
FbaI TGATCA 1 cut(s) 178
FspBI CTAG 4 cut(s) 234, 288, 369, 654
HaeIII GGCC 1 cut(s) 689
Hin1II CATG 4 cut(s) 205, 598, 790, 802
HinfI GANTC 4 cut(s) 284, 422, 571, 695
Hpy166II GTNNAC 1 cut(s) 159
Hpy188I TCNGA 3 cut(s) 226, 249, 432
Hpy188III TCNNGA 1 cut(s) 383
Hpy8I GTNNAC 1 cut(s) 159
HpyAV CCTTC 1 cut(s) 244
HpyCH4III ACNGT 1 cut(s) 781
HpyCH4V TGCA 7 cut(s) 121, 139, 196, 513, 548, 581, 786
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpyF3I CTNAG 4 cut(s) 225, 241, 273, 324
Hsp92II CATG 4 cut(s) 205, 598, 790, 802
Ksp22I TGATCA 1 cut(s) 178
Kzo9I GATC 2 cut(s) 92, 178
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 9 cut(s) 12, 30, 158, 189, 383, 396, 423, 450, 684
LweI GCATC 3 cut(s) 183, 590, 609
MaeI CTAG 4 cut(s) 234, 288, 369, 654
MaeIII GTNAC 1 cut(s) 55
MalI GATC 2 cut(s) 94, 180
MboI GATC 2 cut(s) 92, 178
MboII GAAGA 4 cut(s) 328, 376, 431, 680
MfeI CAATTG 2 cut(s) 164, 182
MlsI TGGCCA 1 cut(s) 689
MluCI AATT 4 cut(s) 164, 182, 378, 752
MluNI TGGCCA 1 cut(s) 689
MlyI GAGTC 2 cut(s) 293, 565
MmeI TCCRAC 1 cut(s) 25
MnlI CCTC 6 cut(s) 32, 271, 274, 349, 460, 633
Mox20I TGGCCA 1 cut(s) 689
Mph1103I ATGCAT 1 cut(s) 583
MscI TGGCCA 1 cut(s) 689
MseI TTAA 5 cut(s) 152, 188, 339, 588, 732
Msp20I TGGCCA 1 cut(s) 689
MspR9I CCNGG 1 cut(s) 438
MunI CAATTG 2 cut(s) 164, 182
Mva1269I GAATGC 1 cut(s) 561
MvaI CCWGG 1 cut(s) 438
MwoI GCNNNNNNNGC 1 cut(s) 145
NdeII GATC 2 cut(s) 92, 178
NlaIII CATG 4 cut(s) 205, 598, 790, 802
NlaIV GGNNCC 2 cut(s) 471, 768
NmuCI GTSAC 1 cut(s) 55
NsiI ATGCAT 1 cut(s) 583
PctI GAATGC 1 cut(s) 561
PfeI GAWTC 2 cut(s) 422, 695
PleI GAGTC 2 cut(s) 292, 565
PpsI GAGTC 2 cut(s) 292, 565
Psp6I CCWGG 1 cut(s) 436
PspGI CCWGG 1 cut(s) 436
PspN4I GGNNCC 2 cut(s) 471, 768
PspPI GGNCC 1 cut(s) 205
RsaI GTAC 4 cut(s) 71, 351, 373, 614
RsaNI GTAC 4 cut(s) 70, 350, 372, 613
SaqAI TTAA 5 cut(s) 152, 188, 339, 588, 732
Sau3AI GATC 2 cut(s) 92, 178
Sau96I GGNCC 1 cut(s) 205
ScaI AGTACT 1 cut(s) 373
SchI GAGTC 2 cut(s) 293, 565
ScrFI CCNGG 1 cut(s) 438
SfaNI GCATC 3 cut(s) 183, 590, 609
SfcI CTRYAG 1 cut(s) 522
SinI GGWCC 1 cut(s) 205
SpeI ACTAGT 1 cut(s) 368
Sse9I AATT 4 cut(s) 164, 182, 378, 752
SspI AATATT 1 cut(s) 23
SspMI CTAG 4 cut(s) 234, 288, 369, 654
StyD4I CCNGG 1 cut(s) 436
StyI CCWWGG 2 cut(s) 83, 208
TaaI ACNGT 1 cut(s) 781
TaqI TCGA 3 cut(s) 91, 393, 761
TasI AATT 4 cut(s) 164, 182, 378, 752
TatI WGTACW 4 cut(s) 69, 349, 371, 612
TfiI GAWTC 2 cut(s) 422, 695
Tru1I TTAA 5 cut(s) 152, 188, 339, 588, 732
Tru9I TTAA 5 cut(s) 152, 188, 339, 588, 732
TseFI GTSAC 1 cut(s) 55
Tsp45I GTSAC 1 cut(s) 55
TspDTI ATGAA 2 cut(s) 317, 729
VpaK11BI GGWCC 1 cut(s) 205
XapI RAATTY 2 cut(s) 378, 752
XspI CTAG 4 cut(s) 234, 288, 369, 654
ZrmI AGTACT 1 cut(s) 373
Zsp2I ATGCAT 1 cut(s) 583
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.