Rmu_sc0006583.1_g000016

Cytokinin riboside 5'-monophosphate phosphoribohydrolase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006583.1
OG0000321
Physical Location & Seq
Reverse (-)
69649 .. 76527
6879 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006583.1_g000016.1.cds

Sequence Viewer

Length: 1188 bp
atggatctagaggaagaaaatcatgcttctgaagatgacttgtcatctgatgagaagaagggaagaggtccaactctgatgtccgacattatttatggtaggatagctcagttctcaacgcgtttagaagatttgaggatggcgttttcggtgttgggatcattgggttctcatgtttttgtaagaacttctcatcggagacctttaacgattcaatcggtcagagaaagagggaggcgcaacattagtttcaagctctcaaggtcaagggttatgtcaagcaagtctgaattagttgattttgatgagagaacaagcccgattgaggtcaggaaagagatagaacgatgctatgaactgatacacagacttgggagaggggttgtgtatttgggatcttcaaggatgagacatgatcattcacattatttgcaagtacttgagttggggctaatggatgctgctactaaaggtgctttgcaagcaggaaaatcagttggtggatttaagattggtaaagaagctggcgaatggacagcgtcaaattcccatccttacctgccttcagaagtttatctaacatgcaggggcatgctgatgttaaagaggaaggagctcagctttgcagagatgactaccttggctattatggatgaaattcatgaggaccgctcaaggagacgagcttttcatgggtatgatcatcaaatgtctaggaaaggctatgctaatttggaagaggaactaaaactggagttaggaactgaagaagatattgacagagctatattatggaagaaagggcgtgtctataaagagggtaactatttgagtgagacaaccaaacaacgtgttgagaaaattgatgctttaacgaaagatgtgagagagggaattgtattcgctgttggtcggaacgacattttgacccaagctttggagacacctgagcaaccaagccgtgtaagaggtgttggacaatttcttacacacaaggtgtactttaatacgtctagatacaagcctgcaaccaagacacaaatgttggaacaaccgttggaattgatgcaaaaccagatgaacttgtttgcttcattattggatcctgagaagttggatccagctaaactaagcatgatgcgagacatttttagatctagtaatggatctgaaaaagctagctgctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lysine_decarbox

Protein Analysis

395

Amino Acids

45.22

Weight (kDa)

8.74

Isoelectric Point (pI)

47.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000321)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221
prunus_persica Prupe.6G157700_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1
pyrus_communis pycom03g09490 pycom03g19580 pycom07g21940 pycom07g27440 pycom14g09710
rosa_chinensis RchiOBHm_Chr1g0318231 RchiOBHm_Chr1g0318241 RchiOBHm_Chr1g0325001 RchiOBHm_Chr1g0325021 RchiOBHm_Chr2g0112301 RchiOBHm_Chr3g0482281 RchiOBHm_Chr3g0482291 RchiOBHm_Chr4g0390561 RchiOBHm_Chr4g0390571 RchiOBHm_Chr4g0417951 RchiOBHm_Chr7g0232611 RchiOBHm_Chr7g0240601
rosa_laevigata RLG00000001069 RLG00000013674 RLG00000018830 RLG00000020747
rosa_multiflora Rmu_co8364947.1_g000001 Rmu_co8416715.1_g000001 Rmu_sc0001348.1_g000014 Rmu_sc0002986.1_g000026 Rmu_sc0004003.1_g000007 Rmu_sc0005137.1_g000014 Rmu_sc0006583.1_g000016
rosa_roxburghii Rroxscaffold_159G00432800 Rroxscaffold_174G00435170 Rroxscaffold_1G00001870 Rroxscaffold_1G00044480 Rroxscaffold_2G00111880 Rroxscaffold_2G00111890 Rroxscaffold_2G00119670 Rroxscaffold_2G00129450 Rroxscaffold_2G00131520 Rroxscaffold_3G00240880 Rroxscaffold_5G00337440 Rroxscaffold_5G00356220 Rroxscaffold_5G00362390 Rroxscaffold_5G00368260 Rroxscaffold_7G00196230 Rroxscaffold_7G00196240 Rroxscaffold_7G00202020
rosa_rugosa Rorug01G0094700 Rorug02G0050500 Rorug02G0179800 Rorug05G0042800 Rorug05G0043000 Rorug05G0043100 Rorug05G0043200 Rorug06G0045300 Rorug06G0045600 Rorug06G0069400 Rorug07G0213000 Rorug07G0213000
rosa_samantha Rh1AG031600 Rh1DG131700 Rh1DG134800 Rh1DG288000 Rh1DG288100 Rh2AG218500 Rh2AG232500 Rh2BG245900 Rh2CG236700 Rh2DG224300 Rh2DG224400 Rh2DG240200 Rh3AG247300 Rh3BG126600 Rh3BG126700 Rh3BG333600 Rh5AG440500 Rh5AG440600 Rh5BG457800 Rh5DG472700 Rh5DG472800 Rh6BG138000 Rh6BG138100 Rh6BG171500 Rh6BG188400 Rh6BG230000 Rh6CG135600 Rh6CG135700 Rh6CG186300 Rh6CG450300 Rh7AG376100 Rh7CG394800 Rh7CG426100 Rh7CG426200 Rh7DG247700 Rh7DG322600 Rh7DG334300 Rh7DG364700
rosa_wichuraiana Rw2G018040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 567
AccB7I CCANNNNNTGG 1 cut(s) 937
AccBSI CCGCTC 1 cut(s) 672
AccII CGCG 1 cut(s) 121
AciI CCGC 1 cut(s) 670
AclWI GGATC 8 cut(s) 12, 166, 403, 1097, 1110, 1112, 1125, 1174
AcsI RAATTY 2 cut(s) 544, 657
AcuI CTGAAG 3 cut(s) 51, 549, 786
AdeI CACNNNGTG 1 cut(s) 997
AfaI GTAC 2 cut(s) 438, 1001
AfiI CCNNNNNNNGG 2 cut(s) 325, 937
AflIII ACRYGT 2 cut(s) 119, 850
AgsI TTSAA 3 cut(s) 215, 253, 402
Alw21I GWGCWC 1 cut(s) 618
Alw26I GTCTC 6 cut(s) 193, 403, 673, 830, 935, 1137
AlwI GGATC 8 cut(s) 12, 166, 403, 1097, 1110, 1112, 1125, 1174
ApeKI GCWGC 2 cut(s) 461, 1182
ApoI RAATTY 2 cut(s) 544, 657
ArsI GACNNNNNNTTYG 2 cut(s) 919, 951
AspLEI GCGC 1 cut(s) 240
AspS9I GGNCC 2 cut(s) 68, 667
AsuNHI GCTAGC 1 cut(s) 1178
AvaII GGWCC 2 cut(s) 68, 667
BamHI GGATCC 2 cut(s) 1102, 1117
BanII GRGCYC 1 cut(s) 618
Bbv12I GWGCWC 1 cut(s) 618
BbvI GCAGC 2 cut(s) 448, 1169
BccI CCATC 2 cut(s) 133, 558
BceAI ACGGC 1 cut(s) 945
BclI TGATCA 2 cut(s) 415, 700
BcoDI GTCTC 6 cut(s) 193, 403, 673, 830, 935, 1137
BfaI CTAG 5 cut(s) 8, 714, 1014, 1158, 1179
BfuAI ACCTGC 1 cut(s) 567
BglII AGATCT 1 cut(s) 1154
BisI GCNGC 2 cut(s) 462, 1183
BlpI GCTNAGC 1 cut(s) 617
BlsI GCNGC 2 cut(s) 463, 1184
BmcAI AGTACT 1 cut(s) 438
Bme18I GGWCC 2 cut(s) 68, 667
BmgT120I GGNCC 2 cut(s) 68, 667
BmiI GGNNCC 2 cut(s) 1104, 1119
BmsI GCATC 5 cut(s) 338, 448, 856, 1056, 1128
BmtI GCTAGC 1 cut(s) 1182
BplI GAGNNNNNCTC 2 cut(s) 656, 688
BpmI CTGGAG 1 cut(s) 773
Bpu10I CCTNAGC 1 cut(s) 948
Bpu1102I GCTNAGC 1 cut(s) 617
BpuEI CTTGAG 3 cut(s) 244, 461, 658
BsaI GGTCTC 1 cut(s) 193
BsaJI CCNNGG 1 cut(s) 639
Bsc4I CCNNNNNNNGG 2 cut(s) 325, 937
Bse1I ACTGG 1 cut(s) 756
BseDI CCNNGG 1 cut(s) 639
BseGI GGATG 5 cut(s) 144, 411, 463, 550, 658
BseLI CCNNNNNNNGG 2 cut(s) 325, 937
BseMII CTCAG 4 cut(s) 122, 631, 939, 1098
BseNI ACTGG 1 cut(s) 756
BseXI GCAGC 2 cut(s) 448, 1169
Bsh1236I CGCG 1 cut(s) 121
BsiHKAI GWGCWC 1 cut(s) 618
BslI CCNNNNNNNGG 2 cut(s) 325, 937
BsmAI GTCTC 6 cut(s) 193, 403, 673, 830, 935, 1137
BsmBI CGTCTC 1 cut(s) 673
Bso31I GGTCTC 1 cut(s) 193
Bsp1286I GDGCHC 1 cut(s) 618
Bsp143I GATC 9 cut(s) 4, 158, 395, 415, 700, 1102, 1117, 1154, 1166
Bsp1720I GCTNAGC 1 cut(s) 617
BspACI CCGC 1 cut(s) 670
BspCNI CTCAG 4 cut(s) 121, 630, 940, 1099
BspFNI CGCG 1 cut(s) 121
BspHI TCATGA 1 cut(s) 661
BspLI GGNNCC 2 cut(s) 1104, 1119
BspMI ACCTGC 1 cut(s) 567
BspOI GCTAGC 1 cut(s) 1182
BspPI GGATC 8 cut(s) 12, 166, 403, 1097, 1110, 1112, 1125, 1174
BspTNI GGTCTC 1 cut(s) 193
BsrBI CCGCTC 1 cut(s) 672
BsrI ACTGG 1 cut(s) 756
BssECI CCNNGG 1 cut(s) 639
BssMI GATC 9 cut(s) 4, 158, 395, 415, 700, 1102, 1117, 1154, 1166
BssT1I CCWWGG 1 cut(s) 639
Bst4CI ACNGT 1 cut(s) 1056
Bst6I CTCTTC 2 cut(s) 58, 732
BstC8I GCNNGC 5 cut(s) 483, 526, 593, 1026, 1180
BstDEI CTNAG 5 cut(s) 108, 617, 948, 1107, 1130
BstF5I GGATG 5 cut(s) 144, 411, 463, 550, 658
BstFNI CGCG 1 cut(s) 121
BstHHI GCGC 1 cut(s) 240
BstKTI GATC 9 cut(s) 7, 161, 398, 418, 703, 1105, 1120, 1157, 1169
BstMAI GTCTC 6 cut(s) 193, 403, 673, 830, 935, 1137
BstMBI GATC 9 cut(s) 4, 158, 395, 415, 700, 1102, 1117, 1154, 1166
BstMWI GCNNNNNNNGC 1 cut(s) 482
BstNSI RCATGY 2 cut(s) 585, 595
BstUI CGCG 1 cut(s) 121
BstV1I GCAGC 2 cut(s) 448, 1169
BstX2I RGATCY 6 cut(s) 4, 395, 1102, 1117, 1154, 1166
BstYI RGATCY 6 cut(s) 4, 395, 1102, 1117, 1154, 1166
BtsCI GGATG 5 cut(s) 144, 411, 463, 550, 658
BveI ACCTGC 1 cut(s) 567
Cac8I GCNNGC 5 cut(s) 483, 526, 593, 1026, 1180
CciI TCATGA 1 cut(s) 661
CfoI GCGC 1 cut(s) 240
Cfr13I GGNCC 2 cut(s) 68, 667
CseI GACGC 1 cut(s) 528
Csp6I GTAC 2 cut(s) 437, 1000
CviAII CATG 8 cut(s) 23, 173, 413, 582, 592, 662, 692, 1135
CviQI GTAC 2 cut(s) 437, 1000
DdeI CTNAG 5 cut(s) 108, 617, 948, 1107, 1130
DpnI GATC 9 cut(s) 6, 160, 397, 417, 702, 1104, 1119, 1156, 1168
DpnII GATC 9 cut(s) 4, 158, 395, 415, 700, 1102, 1117, 1154, 1166
DraIII CACNNNGTG 1 cut(s) 997
Eam1104I CTCTTC 2 cut(s) 58, 732
EarI CTCTTC 2 cut(s) 58, 732
Ecl136II GAGCTC 1 cut(s) 616
Eco130I CCWWGG 1 cut(s) 639
Eco24I GRGCYC 1 cut(s) 618
Eco31I GGTCTC 1 cut(s) 193
Eco47I GGWCC 2 cut(s) 68, 667
Eco53kI GAGCTC 1 cut(s) 616
Eco57I CTGAAG 3 cut(s) 51, 549, 786
EcoICRI GAGCTC 1 cut(s) 616
EcoT14I CCWWGG 1 cut(s) 639
EcoT38I GRGCYC 1 cut(s) 618
ErhI CCWWGG 1 cut(s) 639
Esp3I CGTCTC 1 cut(s) 673
FaeI CATG 8 cut(s) 26, 176, 416, 585, 595, 665, 695, 1138
FalI AAGNNNNNCTT 2 cut(s) 986, 1018
FatI CATG 8 cut(s) 22, 172, 412, 581, 591, 661, 691, 1134
FbaI TGATCA 2 cut(s) 415, 700
Fnu4HI GCNGC 2 cut(s) 462, 1183
FokI GGATG 5 cut(s) 151, 418, 470, 537, 665
FriOI GRGCYC 1 cut(s) 618
Fsp4HI GCNGC 2 cut(s) 462, 1183
FspBI CTAG 5 cut(s) 8, 714, 1014, 1158, 1179
GlaI GCGC 1 cut(s) 239
GluI GCNGC 2 cut(s) 462, 1183
GsuI CTGGAG 1 cut(s) 773
HgaI GACGC 1 cut(s) 528
HhaI GCGC 1 cut(s) 240
Hin1II CATG 8 cut(s) 26, 176, 416, 585, 595, 665, 695, 1138
Hin6I GCGC 1 cut(s) 238
HinP1I GCGC 1 cut(s) 238
HindIII AAGCTT 1 cut(s) 933
HinfI GANTC 1 cut(s) 211
Hpy166II GTNNAC 1 cut(s) 1000
Hpy188III TCNNGA 5 cut(s) 8, 331, 662, 1014, 1106
Hpy8I GTNNAC 1 cut(s) 1000
HpyAV CCTTC 3 cut(s) 52, 573, 604
HpyCH4III ACNGT 1 cut(s) 1056
HpyCH4IV ACGT 2 cut(s) 850, 1010
HpyCH4V TGCA 6 cut(s) 433, 481, 585, 626, 1028, 1069
HpyF10VI GCNNNNNNNGC 1 cut(s) 482
HpyF3I CTNAG 5 cut(s) 108, 617, 948, 1107, 1130
HpySE526I ACGT 2 cut(s) 850, 1010
Hsp92II CATG 8 cut(s) 26, 176, 416, 585, 595, 665, 695, 1138
HspAI GCGC 1 cut(s) 238
Ksp22I TGATCA 2 cut(s) 415, 700
Kzo9I GATC 9 cut(s) 4, 158, 395, 415, 700, 1102, 1117, 1154, 1166
LmnI GCTCC 1 cut(s) 613
Lsp1109I GCAGC 2 cut(s) 448, 1169
LweI GCATC 5 cut(s) 338, 448, 856, 1056, 1128
MaeI CTAG 5 cut(s) 8, 714, 1014, 1158, 1179
MaeII ACGT 2 cut(s) 850, 1010
MaeIII GTNAC 1 cut(s) 821
MalI GATC 9 cut(s) 6, 160, 397, 417, 702, 1104, 1119, 1156, 1168
MbiI CCGCTC 1 cut(s) 672
MboI GATC 9 cut(s) 4, 158, 395, 415, 700, 1102, 1117, 1154, 1166
MflI RGATCY 6 cut(s) 4, 395, 1102, 1117, 1154, 1166
MhlI GDGCHC 1 cut(s) 618
MluCI AATT 8 cut(s) 290, 544, 657, 730, 861, 894, 980, 1061
MluI ACGCGT 1 cut(s) 119
MmeI TCCRAC 7 cut(s) 95, 108, 893, 955, 1026, 1038, 1095
MseI TTAA 5 cut(s) 206, 507, 602, 872, 1005
MslI CAYNNNNRTG 2 cut(s) 596, 696
MvnI CGCG 1 cut(s) 121
MwoI GCNNNNNNNGC 1 cut(s) 482
NdeII GATC 9 cut(s) 4, 158, 395, 415, 700, 1102, 1117, 1154, 1166
NheI GCTAGC 1 cut(s) 1178
NlaIII CATG 8 cut(s) 26, 176, 416, 585, 595, 665, 695, 1138
NlaIV GGNNCC 2 cut(s) 1104, 1119
NspI RCATGY 2 cut(s) 585, 595
PaeI GCATGC 1 cut(s) 595
PagI TCATGA 1 cut(s) 661
PfeI GAWTC 1 cut(s) 211
PflFI GACNNNGTC 1 cut(s) 538
PflMI CCANNNNNTGG 1 cut(s) 937
PkrI GCNGC 2 cut(s) 463, 1184
Psp124BI GAGCTC 1 cut(s) 618
PspN4I GGNNCC 2 cut(s) 1104, 1119
PspPI GGNCC 2 cut(s) 68, 667
PsuI RGATCY 6 cut(s) 4, 395, 1102, 1117, 1154, 1166
PsyI GACNNNGTC 1 cut(s) 538
RsaI GTAC 2 cut(s) 438, 1001
RsaNI GTAC 2 cut(s) 437, 1000
RseI CAYNNNNRTG 2 cut(s) 596, 696
SacI GAGCTC 1 cut(s) 618
SaqAI TTAA 5 cut(s) 206, 507, 602, 872, 1005
SatI GCNGC 2 cut(s) 462, 1183
Sau3AI GATC 9 cut(s) 4, 158, 395, 415, 700, 1102, 1117, 1154, 1166
Sau96I GGNCC 2 cut(s) 68, 667
ScaI AGTACT 1 cut(s) 438
SduI GDGCHC 1 cut(s) 618
SfaNI GCATC 5 cut(s) 338, 448, 856, 1056, 1128
SinI GGWCC 2 cut(s) 68, 667
SmiMI CAYNNNNRTG 2 cut(s) 596, 696
SmlI CTYRAG 3 cut(s) 259, 440, 673
SmoI CTYRAG 3 cut(s) 259, 440, 673
SphI GCATGC 1 cut(s) 595
Sse9I AATT 8 cut(s) 290, 544, 657, 730, 861, 894, 980, 1061
SsiI CCGC 1 cut(s) 670
SspMI CTAG 5 cut(s) 8, 714, 1014, 1158, 1179
SstI GAGCTC 1 cut(s) 618
StyI CCWWGG 1 cut(s) 639
TaaI ACNGT 1 cut(s) 1056
TaiI ACGT 2 cut(s) 853, 1013
TaqII GACCGA 1 cut(s) 208
TasI AATT 8 cut(s) 290, 544, 657, 730, 861, 894, 980, 1061
TatI WGTACW 2 cut(s) 436, 999
TfiI GAWTC 1 cut(s) 211
Tru1I TTAA 5 cut(s) 206, 507, 602, 872, 1005
Tru9I TTAA 5 cut(s) 206, 507, 602, 872, 1005
TseI GCWGC 2 cut(s) 461, 1182
TspDTI ATGAA 6 cut(s) 369, 650, 669, 680, 1083, 1094
Tth111I GACNNNGTC 1 cut(s) 538
Van91I CCANNNNNTGG 1 cut(s) 937
VpaK11BI GGWCC 2 cut(s) 68, 667
XapI RAATTY 2 cut(s) 544, 657
XbaI TCTAGA 2 cut(s) 7, 1013
XceI RCATGY 2 cut(s) 585, 595
XspI CTAG 5 cut(s) 8, 714, 1014, 1158, 1179
ZrmI AGTACT 1 cut(s) 438
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.