Rh3BG333600

source UniProtKB

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
35195661 .. 35199101
3441 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG333600.1

Sequence Viewer

Length: 492 bp
ATGTCTAGAAAAGGCTATGCCAATTTGGAAGAAGAACTAGATGAAGTGACTAAACATGTTAAGGATGGTATTATATCAACAGCTGGTAGTAATGACATACTGACAATGGATTTGGAAAAGCCTGAATATTCCGGTCGTGTAAGAGGTGTTGGAAGCAATGTCACACCTATTTTGTACTTCAATACTCCAAGGTGTCGATCTCAATCCACCCAAAATCAGTTGTTGCAACAAATGAAGCAAATGCAGAACCAACTTTTAATGTTTACTCAACTGCTACAACATGATCAATTGTTAATGATGCAACACATGGTCCAAGGTAGCCGTGTGTCTGAGAAATCTAGTTGCTCAGTTCAGAAGGACAAAGATGAGACATTATCTAAGGAGAAGGAGTCTAGGGTGGAAATGATGAAACGAAAAGAGAAGAAGTCTAAGAAAGCTACATTTAAAGTCAATGTACAAGAGGCTTTGAAGACTAGTACTAAAATTCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

163

Amino Acids

18.7

Weight (kDa)

9.41

Isoelectric Point (pI)

36.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000321)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221 FvH4_1g20221
prunus_persica Prupe.6G157700_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1 Prupe.6G193600_v2.0.a1
pyrus_communis pycom03g09490 pycom03g19580 pycom07g21940 pycom07g27440 pycom14g09710
rosa_chinensis RchiOBHm_Chr1g0318231 RchiOBHm_Chr1g0318241 RchiOBHm_Chr1g0325001 RchiOBHm_Chr1g0325021 RchiOBHm_Chr2g0112301 RchiOBHm_Chr3g0482281 RchiOBHm_Chr3g0482291 RchiOBHm_Chr4g0390561 RchiOBHm_Chr4g0390571 RchiOBHm_Chr4g0417951 RchiOBHm_Chr7g0232611 RchiOBHm_Chr7g0240601
rosa_laevigata RLG00000001069 RLG00000013674 RLG00000018830 RLG00000020747
rosa_multiflora Rmu_co8364947.1_g000001 Rmu_co8416715.1_g000001 Rmu_sc0001348.1_g000014 Rmu_sc0002986.1_g000026 Rmu_sc0004003.1_g000007 Rmu_sc0005137.1_g000014 Rmu_sc0006583.1_g000016
rosa_roxburghii Rroxscaffold_159G00432800 Rroxscaffold_174G00435170 Rroxscaffold_1G00001870 Rroxscaffold_1G00044480 Rroxscaffold_2G00111880 Rroxscaffold_2G00111890 Rroxscaffold_2G00119670 Rroxscaffold_2G00129450 Rroxscaffold_2G00131520 Rroxscaffold_3G00240880 Rroxscaffold_5G00337440 Rroxscaffold_5G00356220 Rroxscaffold_5G00362390 Rroxscaffold_5G00368260 Rroxscaffold_7G00196230 Rroxscaffold_7G00196240 Rroxscaffold_7G00202020
rosa_rugosa Rorug01G0094700 Rorug02G0050500 Rorug02G0179800 Rorug05G0042800 Rorug05G0043000 Rorug05G0043100 Rorug05G0043200 Rorug06G0045300 Rorug06G0045600 Rorug06G0069400 Rorug07G0213000 Rorug07G0213000
rosa_samantha Rh1AG031600 Rh1DG131700 Rh1DG134800 Rh1DG288000 Rh1DG288100 Rh2AG218500 Rh2AG232500 Rh2BG245900 Rh2CG236700 Rh2DG224300 Rh2DG224400 Rh2DG240200 Rh3AG247300 Rh3BG126600 Rh3BG126700 Rh3BG333600 Rh5AG440500 Rh5AG440600 Rh5BG457800 Rh5DG472700 Rh5DG472800 Rh6BG138000 Rh6BG138100 Rh6BG171500 Rh6BG188400 Rh6BG230000 Rh6CG135600 Rh6CG135700 Rh6CG186300 Rh6CG450300 Rh7AG376100 Rh7CG394800 Rh7CG426100 Rh7CG426200 Rh7DG247700 Rh7DG322600 Rh7DG334300 Rh7DG364700
rosa_wichuraiana Rw2G018040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 483
AfaI GTAC 3 cut(s) 176, 456, 478
AflIII ACRYGT 1 cut(s) 55
AgsI TTSAA 2 cut(s) 181, 469
AhlI ACTAGT 1 cut(s) 473
AluBI AGCT 2 cut(s) 83, 437
AluI AGCT 2 cut(s) 83, 437
Alw26I GTCTC 1 cut(s) 362
ApoI RAATTY 1 cut(s) 483
ArsI GACNNNNNNTTYG 2 cut(s) 94, 126
AspS9I GGNCC 1 cut(s) 310
AvaII GGWCC 1 cut(s) 310
BbsI GAAGAC 1 cut(s) 476
BccI CCATC 1 cut(s) 59
BceAI ACGGC 1 cut(s) 306
BclI TGATCA 1 cut(s) 283
BcoDI GTCTC 1 cut(s) 362
BcuI ACTAGT 1 cut(s) 473
BfaI CTAG 5 cut(s) 6, 38, 339, 393, 474
BmcAI AGTACT 1 cut(s) 478
Bme18I GGWCC 1 cut(s) 310
BmgT120I GGNCC 1 cut(s) 310
BmsI GCATC 1 cut(s) 288
BpiI GAAGAC 1 cut(s) 476
BsaBI GATNNNNATC 1 cut(s) 202
BsaJI CCNNGG 2 cut(s) 188, 313
BsaWI WCCGGW 1 cut(s) 131
BsaXI ACNNNNNCTCC 2 cut(s) 374, 404
Bse3DI GCAATG 1 cut(s) 163
Bse8I GATNNNNATC 1 cut(s) 202
BseDI CCNNGG 2 cut(s) 188, 313
BseGI GGATG 1 cut(s) 70
BseJI GATNNNNATC 1 cut(s) 202
BseMI GCAATG 1 cut(s) 163
BseMII CTCAG 2 cut(s) 321, 360
Bsh1285I CGRYCG 1 cut(s) 136
BsiEI CGRYCG 1 cut(s) 136
BsiSI CCGG 1 cut(s) 132
BsmAI GTCTC 1 cut(s) 362
Bsp1407I TGTACA 1 cut(s) 454
Bsp143I GATC 2 cut(s) 197, 283
BspCNI CTCAG 2 cut(s) 322, 359
BsrDI GCAATG 1 cut(s) 163
BsrGI TGTACA 1 cut(s) 454
BssECI CCNNGG 2 cut(s) 188, 313
BssMI GATC 2 cut(s) 197, 283
BssT1I CCWWGG 2 cut(s) 188, 313
BstAUI TGTACA 1 cut(s) 454
BstDEI CTNAG 4 cut(s) 330, 346, 378, 429
BstF5I GGATG 1 cut(s) 70
BstKTI GATC 2 cut(s) 200, 286
BstMAI GTCTC 1 cut(s) 362
BstMBI GATC 2 cut(s) 197, 283
BstMCI CGRYCG 1 cut(s) 136
BstNSI RCATGY 1 cut(s) 59
BstV2I GAAGAC 1 cut(s) 476
BtsCI GGATG 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 310
Csp6I GTAC 3 cut(s) 175, 455, 477
CviAII CATG 3 cut(s) 56, 281, 307
CviJI RGCY 6 cut(s) 15, 83, 121, 321, 437, 464
CviKI_1 RGCY 6 cut(s) 15, 83, 121, 321, 437, 464
CviQI GTAC 3 cut(s) 175, 455, 477
DdeI CTNAG 4 cut(s) 330, 346, 378, 429
DpnI GATC 2 cut(s) 199, 285
DpnII GATC 2 cut(s) 197, 283
DraI TTTAAA 1 cut(s) 445
Eco130I CCWWGG 2 cut(s) 188, 313
Eco47I GGWCC 1 cut(s) 310
EcoT14I CCWWGG 2 cut(s) 188, 313
ErhI CCWWGG 2 cut(s) 188, 313
FaeI CATG 3 cut(s) 59, 284, 310
FaiI YATR 7 cut(s) 18, 57, 74, 98, 282, 308, 490
FatI CATG 3 cut(s) 55, 280, 306
FbaI TGATCA 1 cut(s) 283
FokI GGATG 1 cut(s) 77
FspBI CTAG 5 cut(s) 6, 38, 339, 393, 474
HapII CCGG 1 cut(s) 132
Hin1II CATG 3 cut(s) 59, 284, 310
HinfI GANTC 1 cut(s) 389
HpaII CCGG 1 cut(s) 132
Hpy166II GTNNAC 1 cut(s) 264
Hpy188I TCNGA 2 cut(s) 331, 354
Hpy188III TCNNGA 1 cut(s) 6
Hpy8I GTNNAC 1 cut(s) 264
HpyAV CCTTC 2 cut(s) 349, 379
HpyCH4V TGCA 3 cut(s) 226, 244, 301
HpyF3I CTNAG 4 cut(s) 330, 346, 378, 429
Hsp92II CATG 3 cut(s) 59, 284, 310
Ksp22I TGATCA 1 cut(s) 283
Kzo9I GATC 2 cut(s) 197, 283
LpnPI CCDG 3 cut(s) 69, 135, 145
LweI GCATC 1 cut(s) 288
MaeI CTAG 5 cut(s) 6, 38, 339, 393, 474
MaeIII GTNAC 2 cut(s) 46, 160
MalI GATC 2 cut(s) 199, 285
MboI GATC 2 cut(s) 197, 283
MboII GAAGA 4 cut(s) 41, 44, 433, 481
MfeI CAATTG 1 cut(s) 287
MluCI AATT 3 cut(s) 22, 287, 483
MlyI GAGTC 1 cut(s) 398
MmeI TCCRAC 1 cut(s) 130
MnlI CCTC 2 cut(s) 137, 454
MseI TTAA 4 cut(s) 60, 257, 293, 444
MspA1I CMGCKG 1 cut(s) 83
MspI CCGG 1 cut(s) 132
MunI CAATTG 1 cut(s) 287
NdeII GATC 2 cut(s) 197, 283
NlaIII CATG 3 cut(s) 59, 284, 310
NmuCI GTSAC 2 cut(s) 46, 160
NspI RCATGY 1 cut(s) 59
PciI ACATGT 1 cut(s) 55
PleI GAGTC 1 cut(s) 397
PpsI GAGTC 1 cut(s) 397
PscI ACATGT 1 cut(s) 55
PspPI GGNCC 1 cut(s) 310
PvuII CAGCTG 1 cut(s) 83
RsaI GTAC 3 cut(s) 176, 456, 478
RsaNI GTAC 3 cut(s) 175, 455, 477
SaqAI TTAA 4 cut(s) 60, 257, 293, 444
Sau3AI GATC 2 cut(s) 197, 283
Sau96I GGNCC 1 cut(s) 310
ScaI AGTACT 1 cut(s) 478
SchI GAGTC 1 cut(s) 398
SetI ASST 6 cut(s) 85, 148, 169, 194, 319, 439
SfaNI GCATC 1 cut(s) 288
SinI GGWCC 1 cut(s) 310
SpeI ACTAGT 1 cut(s) 473
Sse9I AATT 3 cut(s) 22, 287, 483
SspI AATATT 1 cut(s) 128
SspMI CTAG 5 cut(s) 6, 38, 339, 393, 474
StyI CCWWGG 2 cut(s) 188, 313
TaqI TCGA 1 cut(s) 196
TasI AATT 3 cut(s) 22, 287, 483
TatI WGTACW 3 cut(s) 174, 454, 476
Tru1I TTAA 4 cut(s) 60, 257, 293, 444
Tru9I TTAA 4 cut(s) 60, 257, 293, 444
TseFI GTSAC 2 cut(s) 46, 160
Tsp45I GTSAC 2 cut(s) 46, 160
TspDTI ATGAA 3 cut(s) 57, 248, 422
VpaK11BI GGWCC 1 cut(s) 310
XapI RAATTY 1 cut(s) 483
XbaI TCTAGA 1 cut(s) 5
XceI RCATGY 1 cut(s) 59
XspI CTAG 5 cut(s) 6, 38, 339, 393, 474
ZrmI AGTACT 1 cut(s) 478
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.