Rmu_co8426689.1_g000001
NAC Family

(NAC) domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8426689.1
OG0000418
Physical Location & Seq
Forward (+)
183 .. 1280
1098 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8426689.1_g000001.1.cds

Sequence Viewer

Length: 1098 bp
atgatggcatcgggtgcttacccagttggttacagatttcatcctacagacctggaattggtggcttactacctccacaaccgggttgccatggttgatcagtttcgctccagtccaatccttgattgccctgacttctatggcaaaaatgagccctggctcatttgggacatgttccgtgcccaatccaacaatatgaaagaggaagaaactctctatttctttactcaccgcaaaaaattgaatcccaaagcgaaaaaatttgatagaaaagtgggatcgggaacatggagtgcccaatattcaaaaaatgttgttgctgctgatgattacagtgttgttggaattaagagagaatttcggtatgagggtggatctgatccacatcaaaatggggcttggttgatgcaggagtacgagatcacatctcacaatgatctcgtactctgcaccctcagaaagaaccccagaaaacttccacccccaacttctcctgctcctctgaatcagagccacattattattagcaacaaaaggaagatgaaattcagtgagggtgaggaggatataaacacaaagacagagagtttcaaaagaaaaaaaacggaacctcctaaacaaaaacaacaactaatgttgccctctacctcttgcttgtttgagcagcagtttgatcaatctaaaatattgtttgatatcgatgagctctgttatattgatgatcagcaggagagcaatgatgatctcatggcttcatttgctccatcatttgttactgatgatctcatggcttcatttgctccatcatttgttaccgatgatcagcttgaggttgttgaggttgagaaggagggcagtaatgatgatctcatggcctcagctggtcaaccgttatctgctagtgatgatcagattcaaactgttcaggtcgacgagactaataattccattactaattctcctaatgatacttcatatccgtattttgatcctgaagttgaggcattctttggcttgactactgatgatatatacgatgatgatgactgtcagttttcgagttctgaaatacaggcattcttagcttgtctggactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM

Protein Analysis

365

Amino Acids

41.7

Weight (kDa)

4.55

Isoelectric Point (pI)

48.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000418)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g25200 FvH4_5g34450 FvH4_6g05730 FvH4_6g05740 FvH4_7g06570
rosa_chinensis RchiOBHm_Chr1g0333911 RchiOBHm_Chr3g0454621 RchiOBHm_Chr3g0454651 RchiOBHm_Chr5g0045711 RchiOBHm_Chr5g0045741 RchiOBHm_Chr5g0045961 RchiOBHm_Chr5g0048841 RchiOBHm_Chr5g0048911 RchiOBHm_Chr6g0266631 RchiOBHm_Chr6g0266821 RchiOBHm_Chr7g0235081
rosa_laevigata RLG00000001184 RLG00000010084 RLG00000013949 RLG00000013954 RLG00000013958 RLG00000013962 RLG00000013991 RLG00000014031 RLG00000014041 RLG00000014077 RLG00000014088 RLG00000014094 RLG00000025427 RLG00000025429 RLG00000029394 RLG00000029510 RLG00000029526 RLG00000034372 RLG00000034376
rosa_multiflora Rmu_co8426689.1_g000001 Rmu_co8428107.1_g000001 Rmu_sc0000026.1_g000016 Rmu_sc0000115.1_g000020 Rmu_sc0001035.1_g000067 Rmu_sc0001035.1_g000078 Rmu_sc0001208.1_g000032 Rmu_sc0001208.1_g000034 Rmu_sc0001792.1_g000031 Rmu_sc0001792.1_g000034 Rmu_sc0002239.1_g000009 Rmu_sc0002722.1_g000010 Rmu_sc0003628.1_g000026 Rmu_sc0004304.1_g000006 Rmu_sc0006003.1_g000019 Rmu_sc0006413.1_g000005 Rmu_sc0006413.1_g000020 Rmu_sc0007177.1_g000007 Rmu_sc0020815.1_g000004
rosa_roxburghii Rroxscaffold_1G00033010 Rroxscaffold_3G00226320 Rroxscaffold_6G00424890 Rroxscaffold_6G00424920 Rroxscaffold_7G00195150
rosa_rugosa Rorug01G0112100 Rorug01G0112200 Rorug01G0119400 Rorug03G0000700 Rorug03G0000900 Rorug03G0211800 Rorug03G0211900 Rorug03G0212000 Rorug03G0212100 Rorug05G0224400 Rorug05G0232500 Rorug05G0232700 Rorug05G0573400 Rorug06G0025800 Rorug07G0143000 Rorug07G0143100
rosa_samantha Rh1AG136300 Rh1DG141400 Rh1DG146800 Rh3AG060600 Rh3AG060800 Rh6BG147300 Rh6BG148700 Rh6BG149100 Rh6BG160100 Rh6BG161000 Rh7AG442200
rosa_wichuraiana Rw0G021480 Rw1G011300 Rw3G004710 Rw3G004730 Rw3G025710 Rw5G028590 Rw5G028720 Rw5G028760 Rw5G030090 Rw5G030310 Rw5G030530 Rw7G036760

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 930
AciI CCGC 1 cut(s) 232
AclWI GGATC 4 cut(s) 286, 374, 382, 983
AcsI RAATTY 3 cut(s) 260, 356, 545
AcuI CTGAAG 1 cut(s) 1014
AfaI GTAC 2 cut(s) 416, 444
AfiI CCNNNNNNNGG 2 cut(s) 58, 82
AflIII ACRYGT 1 cut(s) 171
AgsI TTSAA 4 cut(s) 244, 306, 592, 917
AjnI CCWGG 2 cut(s) 51, 155
AluBI AGCT 4 cut(s) 706, 826, 881, 1085
AluI AGCT 4 cut(s) 706, 826, 881, 1085
Alw21I GWGCWC 1 cut(s) 708
Alw26I GTCTC 1 cut(s) 929
AlwI GGATC 4 cut(s) 286, 374, 382, 983
AoxI GGCC 1 cut(s) 873
ApeKI GCWGC 2 cut(s) 320, 664
ApoI RAATTY 3 cut(s) 260, 356, 545
AsuC2I CCSGG 1 cut(s) 83
AsuHPI GGTGA 2 cut(s) 221, 569
BaeGI GKGCMC 2 cut(s) 184, 298
BanII GRGCYC 2 cut(s) 156, 708
Bbv12I GWGCWC 1 cut(s) 708
BbvCI CCTCAGC 1 cut(s) 877
BbvI GCAGC 2 cut(s) 307, 676
BccI CCATC 2 cut(s) 772, 811
BciT130I CCWGG 2 cut(s) 53, 157
BclI TGATCA 5 cut(s) 97, 673, 721, 820, 907
BcnI CCSGG 1 cut(s) 83
BcoDI GTCTC 1 cut(s) 929
BfaI CTAG 1 cut(s) 900
BfmI CTRYAG 1 cut(s) 45
BisI GCNGC 2 cut(s) 321, 665
BlsI GCNGC 2 cut(s) 322, 666
Bme1390I CCNGG 3 cut(s) 53, 83, 157
BmiI GGNNCC 1 cut(s) 609
BmrFI CCNGG 3 cut(s) 53, 83, 157
BmrI ACTGGG 1 cut(s) 17
BmsI GCATC 2 cut(s) 17, 396
BmuI ACTGGG 1 cut(s) 17
BpmI CTGGAG 1 cut(s) 94
Bpu10I CCTNAGC 1 cut(s) 877
BpuEI CTTGAG 1 cut(s) 848
BpuMI CCSGG 1 cut(s) 83
Bsa29I ATCGAT 1 cut(s) 699
BsaBI GATNNNNATC 1 cut(s) 384
BsaJI CCNNGG 2 cut(s) 90, 155
BsaXI ACNNNNNCTCC 4 cut(s) 595, 625, 943, 973
Bsc4I CCNNNNNNNGG 2 cut(s) 58, 82
Bse1I ACTGG 2 cut(s) 23, 111
Bse3DI GCAATG 1 cut(s) 742
Bse8I GATNNNNATC 1 cut(s) 384
BseBI CCWGG 2 cut(s) 53, 157
BseCI ATCGAT 1 cut(s) 699
BseDI CCNNGG 2 cut(s) 90, 155
BseGI GGATG 1 cut(s) 40
BseJI GATNNNNATC 1 cut(s) 384
BseLI CCNNNNNNNGG 2 cut(s) 58, 82
BseMI GCAATG 1 cut(s) 742
BseMII CTCAG 2 cut(s) 469, 891
BseNI ACTGG 2 cut(s) 23, 111
BseRI GAGGAG 2 cut(s) 489, 575
BseSI GKGCMC 2 cut(s) 184, 298
BseXI GCAGC 2 cut(s) 307, 676
BsgI GTGCAG 1 cut(s) 433
BshFI GGCC 1 cut(s) 875
BshVI ATCGAT 1 cut(s) 699
BsiHKAI GWGCWC 1 cut(s) 708
BsiSI CCGG 1 cut(s) 82
BslFI GGGAC 1 cut(s) 182
BslI CCNNNNNNNGG 2 cut(s) 58, 82
BsmAI GTCTC 1 cut(s) 929
BsmFI GGGAC 1 cut(s) 182
BsmI GAATGC 2 cut(s) 1004, 1076
BsnI GGCC 1 cut(s) 875
Bsp1286I GDGCHC 4 cut(s) 156, 184, 298, 708
Bsp19I CCATGG 1 cut(s) 90
BspACI CCGC 1 cut(s) 232
BspANI GGCC 1 cut(s) 875
BspCNI CTCAG 2 cut(s) 468, 890
BspDI ATCGAT 1 cut(s) 699
BspLI GGNNCC 1 cut(s) 609
BspPI GGATC 4 cut(s) 286, 374, 382, 983
BsrDI GCAATG 1 cut(s) 742
BsrI ACTGG 2 cut(s) 23, 111
BssECI CCNNGG 2 cut(s) 90, 155
BssT1I CCWWGG 1 cut(s) 90
Bst2UI CCWGG 2 cut(s) 53, 157
Bst4CI ACNGT 4 cut(s) 335, 891, 922, 1049
BstAPI GCANNNNNTGC 1 cut(s) 14
BstDEI CTNAG 3 cut(s) 455, 877, 1081
BstDSI CCRYGG 1 cut(s) 90
BstF5I GGATG 1 cut(s) 40
BstMAI GTCTC 1 cut(s) 929
BstMWI GCNNNNNNNGC 4 cut(s) 14, 758, 797, 1082
BstNI CCWGG 2 cut(s) 53, 157
BstNSI RCATGY 1 cut(s) 175
BstSCI CCNGG 3 cut(s) 51, 81, 155
BstSFI CTRYAG 1 cut(s) 45
BstSLI GKGCMC 2 cut(s) 184, 298
BstV1I GCAGC 2 cut(s) 307, 676
BstX2I RGATCY 1 cut(s) 374
BstYI RGATCY 1 cut(s) 374
Bsu15I ATCGAT 1 cut(s) 699
BsuRI GGCC 1 cut(s) 875
BsuTUI ATCGAT 1 cut(s) 699
BtgI CCRYGG 1 cut(s) 90
BtsCI GGATG 1 cut(s) 40
BtsIMutI CAGTG 2 cut(s) 340, 556
ClaI ATCGAT 1 cut(s) 699
Csp6I GTAC 2 cut(s) 415, 443
CviAII CATG 6 cut(s) 91, 172, 288, 748, 787, 871
CviQI GTAC 2 cut(s) 415, 443
DdeI CTNAG 3 cut(s) 455, 877, 1081
Ecl136II GAGCTC 1 cut(s) 706
Eco130I CCWWGG 1 cut(s) 90
Eco24I GRGCYC 2 cut(s) 156, 708
Eco32I GATATC 1 cut(s) 697
Eco53kI GAGCTC 1 cut(s) 706
Eco57I CTGAAG 1 cut(s) 1014
EcoICRI GAGCTC 1 cut(s) 706
EcoRII CCWGG 2 cut(s) 51, 155
EcoRV GATATC 1 cut(s) 697
EcoT14I CCWWGG 1 cut(s) 90
EcoT38I GRGCYC 2 cut(s) 156, 708
ErhI CCWWGG 1 cut(s) 90
FaeI CATG 6 cut(s) 94, 175, 291, 751, 790, 874
FaqI GGGAC 1 cut(s) 182
FatI CATG 6 cut(s) 90, 171, 287, 747, 786, 870
FbaI TGATCA 5 cut(s) 97, 673, 721, 820, 907
FblI GTMKAC 1 cut(s) 930
Fnu4HI GCNGC 2 cut(s) 321, 665
FokI GGATG 1 cut(s) 27
FriOI GRGCYC 2 cut(s) 156, 708
Fsp4HI GCNGC 2 cut(s) 321, 665
FspBI CTAG 1 cut(s) 900
GluI GCNGC 2 cut(s) 321, 665
GsuI CTGGAG 1 cut(s) 94
HaeIII GGCC 1 cut(s) 875
HapII CCGG 1 cut(s) 82
Hin1II CATG 6 cut(s) 94, 175, 291, 751, 790, 874
HincII GTYRAC 2 cut(s) 887, 931
HindII GTYRAC 2 cut(s) 887, 931
HinfI GANTC 3 cut(s) 244, 505, 913
HpaII CCGG 1 cut(s) 82
HphI GGTGA 2 cut(s) 221, 569
Hpy166II GTNNAC 2 cut(s) 887, 931
Hpy188I TCNGA 6 cut(s) 379, 458, 504, 510, 912, 1066
Hpy188III TCNNGA 3 cut(s) 282, 992, 1091
Hpy8I GTNNAC 2 cut(s) 887, 931
Hpy99I CGWCG 1 cut(s) 935
HpyAV CCTTC 1 cut(s) 841
HpyCH4III ACNGT 4 cut(s) 335, 891, 922, 1049
HpyCH4V TGCA 2 cut(s) 409, 450
HpyF10VI GCNNNNNNNGC 4 cut(s) 14, 758, 797, 1082
HpyF3I CTNAG 3 cut(s) 455, 877, 1081
Hsp92II CATG 6 cut(s) 94, 175, 291, 751, 790, 874
Ksp22I TGATCA 5 cut(s) 97, 673, 721, 820, 907
LmnI GCTCC 4 cut(s) 113, 502, 766, 805
Lsp1109I GCAGC 2 cut(s) 307, 676
LweI GCATC 2 cut(s) 17, 396
MaeI CTAG 1 cut(s) 900
MaeIII GTNAC 3 cut(s) 29, 772, 811
MboII GAAGA 2 cut(s) 218, 550
MflI RGATCY 1 cut(s) 374
MhlI GDGCHC 4 cut(s) 156, 184, 298, 708
MluCI AATT 8 cut(s) 56, 239, 260, 345, 356, 545, 943, 955
MmeI TCCRAC 2 cut(s) 213, 322
MseI TTAA 1 cut(s) 348
MslI CAYNNNNRTG 1 cut(s) 390
MspA1I CMGCKG 1 cut(s) 881
MspI CCGG 1 cut(s) 82
MspR9I CCNGG 3 cut(s) 53, 83, 157
Mva1269I GAATGC 2 cut(s) 1004, 1076
MvaI CCWGG 2 cut(s) 53, 157
MwoI GCNNNNNNNGC 4 cut(s) 14, 758, 797, 1082
NciI CCSGG 1 cut(s) 83
NcoI CCATGG 1 cut(s) 90
NlaIII CATG 6 cut(s) 94, 175, 291, 751, 790, 874
NlaIV GGNNCC 1 cut(s) 609
NspI RCATGY 1 cut(s) 175
PciI ACATGT 1 cut(s) 171
PctI GAATGC 2 cut(s) 1004, 1076
PfeI GAWTC 3 cut(s) 244, 505, 913
PkrI GCNGC 2 cut(s) 322, 666
PscI ACATGT 1 cut(s) 171
Psp124BI GAGCTC 1 cut(s) 708
Psp6I CCWGG 2 cut(s) 51, 155
PspGI CCWGG 2 cut(s) 51, 155
PspN4I GGNNCC 1 cut(s) 609
PsuI RGATCY 1 cut(s) 374
PvuII CAGCTG 1 cut(s) 881
RsaI GTAC 2 cut(s) 416, 444
RsaNI GTAC 2 cut(s) 415, 443
RseI CAYNNNNRTG 1 cut(s) 390
SacI GAGCTC 1 cut(s) 708
SalI GTCGAC 1 cut(s) 929
SaqAI TTAA 1 cut(s) 348
SatI GCNGC 2 cut(s) 321, 665
ScrFI CCNGG 3 cut(s) 53, 83, 157
SduI GDGCHC 4 cut(s) 156, 184, 298, 708
SfaNI GCATC 2 cut(s) 17, 396
SfcI CTRYAG 1 cut(s) 45
SmiMI CAYNNNNRTG 1 cut(s) 390
SmlI CTYRAG 1 cut(s) 827
SmoI CTYRAG 1 cut(s) 827
Sse9I AATT 8 cut(s) 56, 239, 260, 345, 356, 545, 943, 955
SsiI CCGC 1 cut(s) 232
SspI AATATT 2 cut(s) 302, 687
SspMI CTAG 1 cut(s) 900
SstI GAGCTC 1 cut(s) 708
StyD4I CCNGG 3 cut(s) 51, 81, 155
StyI CCWWGG 1 cut(s) 90
TaaI ACNGT 4 cut(s) 335, 891, 922, 1049
TaqI TCGA 3 cut(s) 699, 930, 1058
TasI AATT 8 cut(s) 56, 239, 260, 345, 356, 545, 943, 955
TfiI GAWTC 3 cut(s) 244, 505, 913
Tru1I TTAA 1 cut(s) 348
Tru9I TTAA 1 cut(s) 348
TscAI CASTG 2 cut(s) 340, 556
TseI GCWGC 2 cut(s) 320, 664
TspDTI ATGAA 6 cut(s) 29, 212, 557, 744, 783, 963
TspGWI ACGGA 3 cut(s) 167, 620, 969
TspRI CASTG 2 cut(s) 340, 556
XapI RAATTY 3 cut(s) 260, 356, 545
XceI RCATGY 1 cut(s) 175
XmiI GTMKAC 1 cut(s) 930
XspI CTAG 1 cut(s) 900
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.