Rmu_sc0002414.1_g000007

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002414.1
Physical Location & Seq
Reverse (-)
11785 .. 13528
1744 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002414.1_g000007.1.cds

Sequence Viewer

Length: 1185 bp
atgatggagcagaagcgtatgttattggctactggaagttgtgagggtgaaggaccctgtactgtgaatatgattgacagatttagcaatcttccggagggagtttttcatcacgttctttcaaaatttggtattaaagaccttgcccgattctgctgtgtctccaaacgatggagagaattatgcctgtcgtctccatcggtggaattttgtggatttagtgaagatggaattatggatatggcatgtgagcttaggttgaagttggtcaatgcattggataggttcttgcttagtcgtggggatcatgagatgaagagctttgttcttttttgggatggtcacagtgatgaagagcttgacgaagcatgtttctgtgttaatgagaatttccgaataatcacctggatccagaatgctgtgaggtgtaaagttgaaaaggtttatcttgacgtcaccttttttgattatgagggggagccattggcatttccatcttgcgtctttcgttctgcatcattgaggtctatagtggttaatatgccacgtacagttgttaaaacaccctccttcactttttcctccaatatcgaaaagttgcatttaagcgatgttgttatacaagacgaggggtttttcgagtggatttcctattcctgcaaatccttgaaggatgtaactctttcagcagttcgtgagatacgtagtatcaccattgaaagctcgtctttggaaaaattttatttcattaattacgaggttgatgaaacctgccatattaacatctctggtgagaaacttgaagaaataaatgctgcatatagggaggaatgcatgcaagctcgattggatgagatttggtacttgcaaatgaatattggtagctttgctgatgatctagtcccggcagtcgtctgtcttttaagaggaacaccagagttgtgtactttatacattcgctataaaccaacttcactcgatcataaatctaatacatctgggtttgatatggagtattggaagatgcaaaacctggattttgtttctcaggttgaggatgttaccatagagcttagtgctgggtctaatgggattgagttagctagttacttgagcatgctgagagcctggagaaaatggtcattaggtatttggccgagcactctaatgctatggggaagttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

394

Amino Acids

45.27

Weight (kDa)

4.92

Isoelectric Point (pI)

48.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000241)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g18954 FvH4_6g18982 FvH4_6g19010 FvH4_6g19020 FvH4_6g19020 FvH4_6g19030 FvH4_6g19030 FvH4_6g19040 FvH4_6g19040 FvH4_6g19040 FvH4_6g19051 FvH4_6g19090 FvH4_6g19090 FvH4_6g19090 FvH4_6g33920 FvH4_6g33940
malus_domestica MD00G1221800.v1.1 MD04G1145400.v1.1 MD12G1026400.v1.1 MD12G1026500.v1.1 MD12G1026700.v1.1 MD12G1026800.v1.1 MD14G1024900.v1.1 MD14G1025000.v1.1 MD14G1025100.v1.1 MD14G1025200.v1.1 MD14G1025300.v1.1 MD14G1025400.v1.1 MD14G1025600.v1.1 MD14G1026200.v1.1 MD14G1026700.v1.1
prunus_persica Prupe.7G104800_v2.0.a1 Prupe.7G104900_v2.0.a1 Prupe.7G105000_v2.0.a1 Prupe.7G105500_v2.0.a1 Prupe.7G105500_v2.0.a1 Prupe.7G105600_v2.0.a1 Prupe.7G105900_v2.0.a1 Prupe.7G106200_v2.0.a1
pyrus_communis pycom04g13160 pycom07g14430 pycom12g02570 pycom14g02380 pycom14g02430 pycom14g02470 pycom14g02480 pycom14g02490
rosa_chinensis RchiOBHm_Chr3g0474001 RchiOBHm_Chr3g0474011 RchiOBHm_Chr3g0474021 RchiOBHm_Chr3g0474031 RchiOBHm_Chr3g0474041 RchiOBHm_Chr3g0474111 RchiOBHm_Chr3g0474131 RchiOBHm_Chr3g0474161 RchiOBHm_Chr3g0474191
rosa_laevigata RLG00000023848 RLG00000023942 RLG00000023944 RLG00000023946 RLG00000023948 RLG00000023956 RLG00000023957 RLG00000023958
rosa_multiflora Rmu_co8028860.1_g000001 Rmu_sc0002414.1_g000007 Rmu_sc0003170.1_g000008 Rmu_sc0003170.1_g000009 Rmu_sc0004167.1_g000001 Rmu_sc0004507.1_g000023 Rmu_sc0004507.1_g000029 Rmu_sc0004507.1_g000030 Rmu_sc0004507.1_g000032 Rmu_sc0004507.1_g000045 Rmu_sc0005137.1_g000004 Rmu_sc0015051.1_g000002 Rmu_sc0027615.1_g000001 Rmu_sc0027615.1_g000002
rosa_roxburghii Rroxscaffold_6G00407440 Rroxscaffold_6G00407450 Rroxscaffold_6G00407470 Rroxscaffold_6G00407550 Rroxscaffold_6G00407560 Rroxscaffold_6G00407570
rosa_rugosa Rorug03G0137600 Rorug03G0137600 Rorug03G0137600 Rorug03G0138800 Rorug03G0138900 Rorug03G0139200 Rorug03G0139300 Rorug03G0139300 Rorug03G0139400 Rorug03G0139500
rosa_samantha Rh3AG187700 Rh3AG187800 Rh3AG187900 Rh3AG188000 Rh3AG188100 Rh3AG188700 Rh3AG188900 Rh3AG189100 Rh3AG189200 Rh3AG189800 Rh3BG216500 Rh3BG216600 Rh3BG216700 Rh3BG216800 Rh3BG216900 Rh3BG218300 Rh3BG218500 Rh3BG219000 Rh3CG212900 Rh3CG213000 Rh3CG213100 Rh3CG213200 Rh3CG214000 Rh3CG214200 Rh3CG214400 Rh3CG222800 Rh3DG212300 Rh3DG212400 Rh3DG212500 Rh3DG212600 Rh3DG212700 Rh3DG213200 Rh3DG213500 Rh3DG213700 Rh3DG213800 Rh3DG214400 Rh3DG214500 Rh3DG223800
rosa_wichuraiana Rw3G017170 Rw3G017200 Rw3G017210 Rw3G017220 Rw3G017230 Rw3G017290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 456
Acc36I ACCTGC 1 cut(s) 779
AccB7I CCANNNNNTGG 1 cut(s) 171
AccIII TCCGGA 1 cut(s) 94
AclWI GGATC 3 cut(s) 312, 403, 416
AcoI YGGCCR 1 cut(s) 1154
AcsI RAATTY 4 cut(s) 125, 206, 388, 737
AcyI GRCGYC 1 cut(s) 453
AfaI GTAC 4 cut(s) 61, 550, 863, 946
AfiI CCNNNNNNNGG 1 cut(s) 171
AgsI TTSAA 6 cut(s) 123, 262, 437, 670, 719, 803
AjnI CCWGG 3 cut(s) 404, 1032, 1127
AluBI AGCT 8 cut(s) 253, 321, 358, 723, 842, 885, 1072, 1103
AluI AGCT 8 cut(s) 253, 321, 358, 723, 842, 885, 1072, 1103
Alw21I GWGCWC 1 cut(s) 1163
Alw26I GTCTC 2 cut(s) 166, 198
AlwI GGATC 3 cut(s) 312, 403, 416
Aor13HI TCCGGA 1 cut(s) 94
AoxI GGCC 1 cut(s) 1154
ApeKI GCWGC 1 cut(s) 815
ApoI RAATTY 4 cut(s) 125, 206, 388, 737
AseI ATTAAT 1 cut(s) 750
AspS9I GGNCC 1 cut(s) 53
AsuC2I CCSGG 1 cut(s) 905
AsuHPI GGTGA 5 cut(s) 59, 394, 448, 703, 803
AvaII GGWCC 1 cut(s) 53
BamHI GGATCC 1 cut(s) 408
Bbv12I GWGCWC 1 cut(s) 1163
BbvI GCAGC 1 cut(s) 802
BccI CCATC 5 cut(s) 165, 205, 221, 332, 502
BciT130I CCWGG 3 cut(s) 406, 1034, 1129
BcnI CCSGG 1 cut(s) 905
BcoDI GTCTC 2 cut(s) 166, 198
BfaI CTAG 2 cut(s) 899, 1104
BfmI CTRYAG 1 cut(s) 528
BfuAI ACCTGC 1 cut(s) 779
BisI GCNGC 1 cut(s) 816
BlsI GCNGC 1 cut(s) 817
Bme1390I CCNGG 4 cut(s) 406, 905, 1034, 1129
Bme18I GGWCC 1 cut(s) 53
BmgT120I GGNCC 1 cut(s) 53
BmiI GGNNCC 3 cut(s) 55, 410, 480
BmrFI CCNGG 4 cut(s) 406, 905, 1034, 1129
BmsI GCATC 2 cut(s) 524, 1014
BpmI CTGGAG 1 cut(s) 1150
Bpu10I CCTNAGC 1 cut(s) 254
BpuEI CTTGAG 1 cut(s) 1132
BpuMI CCSGG 1 cut(s) 905
BsaAI YACGTR 2 cut(s) 548, 704
BsaHI GRCGYC 1 cut(s) 453
BsaWI WCCGGW 1 cut(s) 94
Bsc4I CCNNNNNNNGG 1 cut(s) 171
Bse1I ACTGG 1 cut(s) 37
BseAI TCCGGA 1 cut(s) 94
BseBI CCWGG 3 cut(s) 406, 1034, 1129
BseGI GGATG 4 cut(s) 343, 679, 856, 1063
BseLI CCNNNNNNNGG 1 cut(s) 171
BseMII CTCAG 2 cut(s) 1061, 1112
BseNI ACTGG 1 cut(s) 37
BseXI GCAGC 1 cut(s) 802
BseYI CCCAGC 1 cut(s) 1079
BshFI GGCC 1 cut(s) 1156
BsiHKAI GWGCWC 1 cut(s) 1163
BsiSI CCGG 2 cut(s) 95, 905
BslFI GGGAC 1 cut(s) 887
BslI CCNNNNNNNGG 1 cut(s) 171
BsmAI GTCTC 2 cut(s) 166, 198
BsmBI CGTCTC 1 cut(s) 198
BsmFI GGGAC 1 cut(s) 887
BsmI GAATGC 2 cut(s) 421, 836
BsnI GGCC 1 cut(s) 1156
Bsp1286I GDGCHC 1 cut(s) 1163
Bsp13I TCCGGA 1 cut(s) 94
Bsp143I GATC 4 cut(s) 304, 408, 895, 979
BspANI GGCC 1 cut(s) 1156
BspCNI CTCAG 2 cut(s) 1060, 1113
BspEI TCCGGA 1 cut(s) 94
BspHI TCATGA 1 cut(s) 307
BspLI GGNNCC 3 cut(s) 55, 410, 480
BspMI ACCTGC 1 cut(s) 779
BspPI GGATC 3 cut(s) 312, 403, 416
BspQI GCTCTTC 2 cut(s) 311, 348
BsrI ACTGG 1 cut(s) 37
BssMI GATC 4 cut(s) 304, 408, 895, 979
BssNI GRCGYC 1 cut(s) 453
Bst2UI CCWGG 3 cut(s) 406, 1034, 1129
Bst4CI ACNGT 3 cut(s) 64, 347, 553
Bst6I CTCTTC 2 cut(s) 311, 348
BstACI GRCGYC 1 cut(s) 453
BstBAI YACGTR 2 cut(s) 548, 704
BstC8I GCNNGC 3 cut(s) 836, 840, 1118
BstDEI CTNAG 5 cut(s) 254, 293, 1047, 1073, 1121
BstF5I GGATG 4 cut(s) 343, 679, 856, 1063
BstKTI GATC 4 cut(s) 307, 411, 898, 982
BstMAI GTCTC 2 cut(s) 166, 198
BstMBI GATC 4 cut(s) 304, 408, 895, 979
BstNI CCWGG 3 cut(s) 406, 1034, 1129
BstNSI RCATGY 4 cut(s) 249, 372, 838, 1120
BstSCI CCNGG 4 cut(s) 404, 903, 1032, 1127
BstSFI CTRYAG 1 cut(s) 528
BstSNI TACGTA 1 cut(s) 704
BstV1I GCAGC 1 cut(s) 802
BstX2I RGATCY 1 cut(s) 408
BstYI RGATCY 1 cut(s) 408
BsuRI GGCC 1 cut(s) 1156
BtgZI GCGATG 1 cut(s) 624
BtsCI GGATG 4 cut(s) 343, 679, 856, 1063
BtsIMutI CAGTG 1 cut(s) 352
BveI ACCTGC 1 cut(s) 779
Cac8I GCNNGC 3 cut(s) 836, 840, 1118
CciI TCATGA 1 cut(s) 307
Cfr13I GGNCC 1 cut(s) 53
CseI GACGC 1 cut(s) 490
Csp6I GTAC 4 cut(s) 60, 549, 862, 945
CviAII CATG 5 cut(s) 246, 308, 369, 835, 1117
CviQI GTAC 4 cut(s) 60, 549, 862, 945
DdeI CTNAG 5 cut(s) 254, 293, 1047, 1073, 1121
DpnI GATC 4 cut(s) 306, 410, 897, 981
DpnII GATC 4 cut(s) 304, 408, 895, 979
EaeI YGGCCR 1 cut(s) 1154
Eam1104I CTCTTC 2 cut(s) 311, 348
EarI CTCTTC 2 cut(s) 311, 348
Eco105I TACGTA 1 cut(s) 704
Eco47I GGWCC 1 cut(s) 53
EcoO109I RGGNCCY 1 cut(s) 53
EcoRII CCWGG 3 cut(s) 404, 1032, 1127
EcoT22I ATGCAT 2 cut(s) 277, 836
Esp3I CGTCTC 1 cut(s) 198
FaeI CATG 5 cut(s) 249, 311, 372, 838, 1120
FalI AAGNNNNNCTT 2 cut(s) 712, 744
FaqI GGGAC 1 cut(s) 887
FatI CATG 5 cut(s) 245, 307, 368, 834, 1116
Fnu4HI GCNGC 1 cut(s) 816
FokI GGATG 4 cut(s) 350, 686, 863, 1070
Fsp4HI GCNGC 1 cut(s) 816
FspBI CTAG 2 cut(s) 899, 1104
GluI GCNGC 1 cut(s) 816
GsaI CCCAGC 1 cut(s) 1083
GsuI CTGGAG 1 cut(s) 1150
HaeIII GGCC 1 cut(s) 1156
HapII CCGG 2 cut(s) 95, 905
HgaI GACGC 1 cut(s) 490
Hin1I GRCGYC 1 cut(s) 453
Hin1II CATG 5 cut(s) 249, 311, 372, 838, 1120
HinfI GANTC 1 cut(s) 150
HpaII CCGG 2 cut(s) 95, 905
HphI GGTGA 5 cut(s) 59, 394, 448, 703, 803
Hpy166II GTNNAC 1 cut(s) 945
Hpy188I TCNGA 1 cut(s) 395
Hpy188III TCNNGA 5 cut(s) 95, 308, 412, 449, 695
Hpy8I GTNNAC 1 cut(s) 945
HpyAV CCTTC 3 cut(s) 44, 580, 664
HpyCH4III ACNGT 3 cut(s) 64, 347, 553
HpyCH4IV ACGT 4 cut(s) 114, 453, 547, 703
HpyCH4V TGCA 9 cut(s) 275, 515, 601, 660, 818, 834, 838, 868, 1027
HpyF3I CTNAG 5 cut(s) 254, 293, 1047, 1073, 1121
HpySE526I ACGT 4 cut(s) 114, 453, 547, 703
Hsp92I GRCGYC 1 cut(s) 453
Hsp92II CATG 5 cut(s) 249, 311, 372, 838, 1120
Kpn2I TCCGGA 1 cut(s) 94
Kzo9I GATC 4 cut(s) 304, 408, 895, 979
LguI GCTCTTC 2 cut(s) 311, 348
LmnI GCTCC 2 cut(s) 7, 478
Lsp1109I GCAGC 1 cut(s) 802
LweI GCATC 2 cut(s) 524, 1014
MaeI CTAG 2 cut(s) 899, 1104
MaeII ACGT 4 cut(s) 114, 453, 547, 703
MaeIII GTNAC 5 cut(s) 341, 454, 676, 1060, 1106
MalI GATC 4 cut(s) 306, 410, 897, 981
MboI GATC 4 cut(s) 304, 408, 895, 979
MboII GAAGA 6 cut(s) 83, 236, 328, 365, 815, 1033
MflI RGATCY 1 cut(s) 408
MhlI GDGCHC 1 cut(s) 1163
MluCI AATT 7 cut(s) 125, 179, 206, 231, 388, 737, 751
Mph1103I ATGCAT 2 cut(s) 277, 836
MroI TCCGGA 1 cut(s) 94
MseI TTAA 9 cut(s) 135, 381, 537, 558, 605, 750, 780, 923, 1183
MslI CAYNNNNRTG 2 cut(s) 348, 1166
MspI CCGG 2 cut(s) 95, 905
MspR9I CCNGG 4 cut(s) 406, 905, 1034, 1129
Mva1269I GAATGC 2 cut(s) 421, 836
MvaI CCWGG 3 cut(s) 406, 1034, 1129
NciI CCSGG 1 cut(s) 905
NdeII GATC 4 cut(s) 304, 408, 895, 979
NlaIII CATG 5 cut(s) 249, 311, 372, 838, 1120
NlaIV GGNNCC 3 cut(s) 55, 410, 480
NmeAIII GCCGAG 1 cut(s) 1182
NmuCI GTSAC 2 cut(s) 341, 454
NsiI ATGCAT 2 cut(s) 277, 836
NspI RCATGY 4 cut(s) 249, 372, 838, 1120
PaeI GCATGC 2 cut(s) 838, 1120
PagI TCATGA 1 cut(s) 307
PciSI GCTCTTC 2 cut(s) 311, 348
PcsI WCGNNNNNNNCGW 1 cut(s) 700
PctI GAATGC 2 cut(s) 421, 836
PfeI GAWTC 1 cut(s) 150
PflMI CCANNNNNTGG 1 cut(s) 171
PkrI GCNGC 1 cut(s) 817
Ppu21I YACGTR 2 cut(s) 548, 704
PpuMI RGGWCCY 1 cut(s) 53
PshBI ATTAAT 1 cut(s) 750
Psp5II RGGWCCY 1 cut(s) 53
Psp6I CCWGG 3 cut(s) 404, 1032, 1127
PspFI CCCAGC 1 cut(s) 1079
PspGI CCWGG 3 cut(s) 404, 1032, 1127
PspN4I GGNNCC 3 cut(s) 55, 410, 480
PspPI GGNCC 1 cut(s) 53
PspPPI RGGWCCY 1 cut(s) 53
PsuI RGATCY 1 cut(s) 408
RsaI GTAC 4 cut(s) 61, 550, 863, 946
RsaNI GTAC 4 cut(s) 60, 549, 862, 945
RseI CAYNNNNRTG 2 cut(s) 348, 1166
SapI GCTCTTC 2 cut(s) 311, 348
SaqAI TTAA 9 cut(s) 135, 381, 537, 558, 605, 750, 780, 923, 1183
SatI GCNGC 1 cut(s) 816
Sau3AI GATC 4 cut(s) 304, 408, 895, 979
Sau96I GGNCC 1 cut(s) 53
ScrFI CCNGG 4 cut(s) 406, 905, 1034, 1129
SduI GDGCHC 1 cut(s) 1163
SfaNI GCATC 2 cut(s) 524, 1014
SfcI CTRYAG 1 cut(s) 528
SinI GGWCC 1 cut(s) 53
SmiMI CAYNNNNRTG 2 cut(s) 348, 1166
SmlI CTYRAG 1 cut(s) 1111
SmoI CTYRAG 1 cut(s) 1111
SnaBI TACGTA 1 cut(s) 704
SphI GCATGC 2 cut(s) 838, 1120
Sse9I AATT 7 cut(s) 125, 179, 206, 231, 388, 737, 751
SspI AATATT 1 cut(s) 877
SspMI CTAG 2 cut(s) 899, 1104
StyD4I CCNGG 4 cut(s) 404, 903, 1032, 1127
TaaI ACNGT 3 cut(s) 64, 347, 553
TaiI ACGT 4 cut(s) 117, 456, 550, 706
TaqI TCGA 4 cut(s) 591, 639, 844, 978
TasI AATT 7 cut(s) 125, 179, 206, 231, 388, 737, 751
TatI WGTACW 2 cut(s) 59, 944
TfiI GAWTC 1 cut(s) 150
Tru1I TTAA 9 cut(s) 135, 381, 537, 558, 605, 750, 780, 923, 1183
Tru9I TTAA 9 cut(s) 135, 381, 537, 558, 605, 750, 780, 923, 1183
TscAI CASTG 1 cut(s) 352
TseFI GTSAC 2 cut(s) 341, 454
TseI GCWGC 1 cut(s) 815
Tsp45I GTSAC 2 cut(s) 341, 454
TspDTI ATGAA 6 cut(s) 98, 329, 366, 736, 780, 887
TspRI CASTG 1 cut(s) 352
Van91I CCANNNNNTGG 1 cut(s) 171
VpaK11BI GGWCC 1 cut(s) 53
VspI ATTAAT 1 cut(s) 750
XapI RAATTY 4 cut(s) 125, 206, 388, 737
XceI RCATGY 4 cut(s) 249, 372, 838, 1120
XspI CTAG 2 cut(s) 899, 1104
ZraI GACGTC 1 cut(s) 454
Zsp2I ATGCAT 2 cut(s) 277, 836
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.