Rmu_ssc0000128.1_g000031

Protein of unknown function (DUF2921)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000128.1
Physical Location & Seq
Reverse (-)
156365 .. 159063
2699 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000128.1_g000031.1.cds

Sequence Viewer

Length: 2634 bp
atgaagcttttcatatccttcttcgtttttaccaccatatccttcaattcgatgccattctttgcttcagctgttcaaatttcttatgctgaccattgtgcttcagttgttcctgagtcaaccgaaaaaataaatgcacaatctcacttggtacatctgattcacacaggttactactacactggtggtggcagtgacattcttaatctatactcgccaaatgatcaggtcaaaaattctattggcttccaatgctgggacattagagaaactaatgtacaagggttgttcaaggttgaaggaactcttgagtttcaagtaacccacaggcatgagcagcaaagcctgccagttcaaacatttccaggttccgtttcctttagactaaatggattctggtcagaatcttctgggaagctttgcatggtcggatcatcatccatttactcagcacaaggtaaacttcttgttcttaagctgtacaatatcatgaattccactagtgttacaagtttgattagtggaaccttcgagcatgtcatgataactgagaatgatcccaagtctttgggaccaatctctattttgctattccctcgcatgaactacgagtacactttggtctcaactaattctagtaacagttgctctggtggaagtgaagataccccaagctctttacaagtagagagattttgttcactactatcatcagtggtactaaatcatgactttcaactcaaatattcaagccactgtgttactgcaaagaactgcaccccaatttctatgtctgattggcctcgggctgtatcgttgaaggacattgtgtgttcagaggataaacgaagtacaagtttagttggtgaaggctcatgggatgcagagaagaatcagctatgtatcattgcttgtcgaatctggaatgaaacaaattctttgaataatactaatgtgggtgattgttcaacaagattgagcttgagatttcctgcaacagggacaattggaagtaccagcagcattgtggggcatatttggagcaccaaaactgtgacagagttgggctactttgaaaagatcacatttgccagtggggaggactgtagttatcaagagtgtctgcttccaggccagacatacgagtatactaaaatggacaaagtaacagagttgtgctcgagaaagaaggctgctaatgacaaggccagcatttacccaaatctgttgttgcatgccatgagtttcattatgcatgctgaaaattctgaagggcaagttggtacaggcaatggtgttcccctttctgttggcgatcaattttacaagaccgattattcaactgtaagcagaaatcaagaatactctttggctcctctaagtcacagctacaactacagcagctcctacaatattagctacaaaatagacctccatctacaatctaatccagcgttgggcaaacagtcagttatatatgaaatgcacatctctgctgaagggatctatgatgatacagaaggaagcctgtgcatggtaggatgccgcaatcttggctcaaacagtcagcaggcaacaaatgattcaatagattgtgagattcttgtcaattttcagttcccaccaacaaatgcaaaggattcacatcatatcaaaggaagcattgaaagcacacgaaagaaatctgatcctcttcattttgaacgcttggatttgtctacagcttccaaggctgtaggaaagcgatctatttggaggatggatgggaagattaccttggttcttatatccaccacacttgtatgtgtttttgctgcattacaactcttccatgtaaaaagaaatcctgaagccattccctctatctccatcttaatgcatctaatgctaacccttggctacatgatacctctggggataaattttcgagccatgttcacgcatgatataaacagccaaaatgtgtaccttggaggcggtggatggcttgaatgtaatgagataatcataagaataacaacattggtagctttcttgatacaattccaccttctgaagctaacttggtcagcaaaatcgggaaatagaacccgaaaggatctccaggtcatggaaaagaaggctctgtttgtggctttacgagtgtatgcgataggggctttagcagctttgtttctgcatacgcagaacctgaggaagagggacaatggcaatgtcttgcattatgtagagtattccatcttggatgccttgatatcttatggtggtctggtcttgggtggttttttgttccctcaaattctgctcaacatgttctgcaaatcaagagaaaatgctctatcagtctggttctacttcggaacaacttttgttcaagcgctgccacatgcatatgaccttttcagggctcacagctatgttggtgaccatttggacaagtactctcacattgatccaagtcgtgcggcagattattttcactccacagcttggaatgccactgcaagcagcggaagtctactgtttgctggtatcatttacttacagcagcagtttgggggtcgttgcatttctcctcgaaagttgcaagagttgggtgcatatgagaatgtccctacagttcatgaagagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

877

Amino Acids

97.62

Weight (kDa)

6.58

Isoelectric Point (pI)

39.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000420)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G21700
fragaria_vesca FvH4_1g10360 FvH4_1g10760 FvH4_2g30370 FvH4_3g09240 FvH4_3g20050 FvH4_3g20280 FvH4_3g20290 FvH4_3g20291 FvH4_3g20340 FvH4_3g20350 FvH4_3g20351 FvH4_3g20380 FvH4_3g20390 FvH4_5g13190 FvH4_6g20070 FvH4_6g42890
malus_domestica MD03G1227000.v1.1 MD10G1294900.v1.1 MD11G1246300.v1.1 MD11G1246400.v1.1 MD11G1246500.v1.1 MD11G1246600.v1.1
prunus_persica Prupe.4G047300_v2.0.a1 Prupe.4G181700_v2.0.a1 Prupe.4G181900_v2.0.a1 Prupe.4G182000_v2.0.a1 Prupe.4G182200_v2.0.a1
pyrus_communis pycom03g17470 pycom10g24670 pycom11g21640
rosa_chinensis RchiOBHm_Chr5g0008381 RchiOBHm_Chr5g0008391 RchiOBHm_Chr5g0033881 RchiOBHm_Chr5g0034171 RchiOBHm_Chr5g0034181 RchiOBHm_Chr5g0034191 RchiOBHm_Chr5g0034201 RchiOBHm_Chr5g0034211 RchiOBHm_Chr5g0034221 RchiOBHm_Chr5g0034231 RchiOBHm_Chr5g0034271 RchiOBHm_Chr5g0034281
rosa_laevigata RLG00000031566 RLG00000031567 RLG00000033506 RLG00000033529 RLG00000033530 RLG00000033531
rosa_multiflora Rmu_co8445509.1_g000001 Rmu_co8470615.1_g000001 Rmu_sc0008805.1_g000003 Rmu_sc0008805.1_g000004 Rmu_ssc0000128.1_g000029 Rmu_ssc0000128.1_g000031 Rmu_ssc0000128.1_g000032 Rmu_ssc0000388.1_g000062 Rmu_ssc0000388.1_g000063
rosa_roxburghii Rroxscaffold_1G00046010 Rroxscaffold_1G00046020 Rroxscaffold_1G00046030 Rroxscaffold_1G00046040 Rroxscaffold_1G00046060 Rroxscaffold_1G00046070 Rroxscaffold_1G00046080 Rroxscaffold_1G00046090
rosa_rugosa Rorug04G0435500 Rorug05G0142900 Rorug05G0144600 Rorug05G0144600 Rorug05G0144700 Rorug05G0144800
rosa_samantha Rh5AG233800 Rh5AG235900 Rh5AG236000 Rh5AG236100 Rh5AG236200 Rh5AG236300 Rh5AG236500 Rh5BG061200 Rh5BG061300 Rh5BG234300 Rh5BG236600 Rh5BG236800 Rh5CG071200 Rh5DG060000 Rh5DG060100 Rh5DG241300 Rh5DG243700 Rh5DG244000 Rh5DG244100
rosa_wichuraiana Rw3G018950 Rw5G005680 Rw5G021330 Rw5G021340 Rw5G021350 Rw5G021550

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 2110, 2490
AccI GTMKAC 3 cut(s) 1148, 1718, 2518
AciI CCGC 4 cut(s) 1546, 1977, 2465, 2511
AclWI GGATC 6 cut(s) 439, 551, 1511, 1682, 2106, 2447
AcsI RAATTY 7 cut(s) 78, 235, 493, 934, 1264, 1921, 2298
AcuI CTGAAG 6 cut(s) 51, 87, 1290, 1518, 1869, 2075
AfeI AGCGCT 1 cut(s) 2379
AfiI CCNNNNNNNGG 7 cut(s) 256, 998, 1457, 1534, 2110, 2404, 2490
AflII CTTAAG 1 cut(s) 473
AflIII ACRYGT 1 cut(s) 2310
AhlI ACTAGT 1 cut(s) 500
AjnI CCWGG 3 cut(s) 364, 1129, 2103
AjuI GAANNNNNNNTTGG 4 cut(s) 1263, 1295, 1760, 1792
Alw21I GWGCWC 2 cut(s) 1046, 1181
Alw26I GTCTC 1 cut(s) 628
AlwI GGATC 6 cut(s) 439, 551, 1511, 1682, 2106, 2447
AlwNI CAGNNNCTG 1 cut(s) 2191
Ama87I CYCGRG 2 cut(s) 804, 1180
Aor51HI AGCGCT 1 cut(s) 2379
AoxI GGCC 3 cut(s) 800, 1132, 1206
ApeKI GCWGC 9 cut(s) 337, 1020, 1193, 1401, 1814, 2165, 2380, 2508, 2548
ApoI RAATTY 7 cut(s) 78, 235, 493, 934, 1264, 1921, 2298
Asp700I GAANNNNTTC 2 cut(s) 8, 1854
AspLEI GCGC 1 cut(s) 2380
AspS9I GGNCC 1 cut(s) 572
AsuHPI GGTGA 3 cut(s) 878, 971, 2435
AvaI CYCGRG 2 cut(s) 804, 1180
AvaII GGWCC 1 cut(s) 572
AxyI CCTNAGG 1 cut(s) 2192
BanII GRGCYC 1 cut(s) 2410
BarI GAAGNNNNNNTAC 2 cut(s) 649, 681
Bbv12I GWGCWC 2 cut(s) 1046, 1181
BbvI GCAGC 9 cut(s) 349, 1032, 1180, 1413, 1801, 2177, 2367, 2520, 2560
BccI CCATC 6 cut(s) 1443, 1753, 1757, 1877, 1977, 2246
BciT130I CCWGG 3 cut(s) 366, 1131, 2105
BclI TGATCA 1 cut(s) 223
BcoDI GTCTC 1 cut(s) 628
BcuI ACTAGT 1 cut(s) 500
BfaI CTAG 2 cut(s) 501, 636
BfmI CTRYAG 5 cut(s) 1105, 1396, 1719, 1734, 2616
BfoI RGCGCY 1 cut(s) 2381
BfrI CTTAAG 1 cut(s) 473
BmcAI AGTACT 1 cut(s) 2441
Bme1390I CCNGG 3 cut(s) 366, 1131, 2105
Bme18I GGWCC 1 cut(s) 572
BmeT110I CYCGRG 2 cut(s) 804, 1180
BmgT120I GGNCC 1 cut(s) 572
BmiI GGNNCC 4 cut(s) 370, 526, 573, 1374
BmrFI CCNGG 3 cut(s) 366, 1131, 2105
BmsI GCATC 5 cut(s) 42, 871, 1532, 1888, 2236
BplI GAGNNNNNCTC 2 cut(s) 1163, 1195
BpmI CTGGAG 1 cut(s) 2087
BpuEI CTTGAG 2 cut(s) 329, 1003
BsaBI GATNNNNATC 2 cut(s) 436, 1644
BsaI GGTCTC 1 cut(s) 628
BsaJI CCNNGG 5 cut(s) 803, 1728, 1776, 1894, 1969
BsaXI ACNNNNNCTCC 2 cut(s) 1388, 1418
Bsc4I CCNNNNNNNGG 7 cut(s) 256, 998, 1457, 1534, 2110, 2404, 2490
Bse1I ACTGG 3 cut(s) 187, 350, 1092
Bse21I CCTNAGG 1 cut(s) 2192
Bse3DI GCAATG 3 cut(s) 906, 1297, 2218
Bse8I GATNNNNATC 2 cut(s) 436, 1644
BseBI CCWGG 3 cut(s) 366, 1131, 2105
BseDI CCNNGG 5 cut(s) 803, 1728, 1776, 1894, 1969
BseGI GGATG 7 cut(s) 437, 886, 1547, 1764, 1768, 1988, 2251
BseJI GATNNNNATC 2 cut(s) 436, 1644
BseLI CCNNNNNNNGG 7 cut(s) 256, 998, 1457, 1534, 2110, 2404, 2490
BseMI GCAATG 3 cut(s) 906, 1297, 2218
BseMII CTCAG 4 cut(s) 105, 462, 540, 2183
BseNI ACTGG 3 cut(s) 187, 350, 1092
BseRI GAGGAG 2 cut(s) 1365, 2565
BseXI GCAGC 9 cut(s) 349, 1032, 1180, 1413, 1801, 2177, 2367, 2520, 2560
BseYI CCCAGC 1 cut(s) 255
BsgI GTGCAG 1 cut(s) 760
BshFI GGCC 3 cut(s) 802, 1134, 1208
BsiHKAI GWGCWC 2 cut(s) 1046, 1181
BsiHKCI CYCGRG 2 cut(s) 804, 1180
BslFI GGGAC 5 cut(s) 272, 585, 1015, 2216, 2597
BslI CCNNNNNNNGG 7 cut(s) 256, 998, 1457, 1534, 2110, 2404, 2490
BsmAI GTCTC 1 cut(s) 628
BsmFI GGGAC 5 cut(s) 272, 585, 1015, 2216, 2597
BsmI GAATGC 1 cut(s) 2500
BsnI GGCC 3 cut(s) 802, 1134, 1208
Bso31I GGTCTC 1 cut(s) 628
BsoBI CYCGRG 2 cut(s) 804, 1180
Bsp1286I GDGCHC 3 cut(s) 1046, 1181, 2410
Bsp1407I TGTACA 2 cut(s) 277, 480
BspACI CCGC 4 cut(s) 1546, 1977, 2465, 2511
BspANI GGCC 3 cut(s) 802, 1134, 1208
BspCNI CTCAG 4 cut(s) 106, 461, 541, 2184
BspHI TCATGA 4 cut(s) 489, 540, 727, 2623
BspLI GGNNCC 4 cut(s) 370, 526, 573, 1374
BspPI GGATC 6 cut(s) 439, 551, 1511, 1682, 2106, 2447
BspTI CTTAAG 1 cut(s) 473
BspTNI GGTCTC 1 cut(s) 628
BsrDI GCAATG 3 cut(s) 906, 1297, 2218
BsrGI TGTACA 2 cut(s) 277, 480
BsrI ACTGG 3 cut(s) 187, 350, 1092
BssECI CCNNGG 5 cut(s) 803, 1728, 1776, 1894, 1969
BssNAI GTATAC 1 cut(s) 1149
BssT1I CCWWGG 4 cut(s) 1728, 1776, 1894, 1969
Bst1107I GTATAC 1 cut(s) 1149
Bst2UI CCWGG 3 cut(s) 366, 1131, 2105
Bst4CI ACNGT 9 cut(s) 644, 758, 1054, 1106, 1345, 1467, 1565, 2523, 2620
Bst6I CTCTTC 4 cut(s) 1698, 1832, 2192, 2622
BstAFI CTTAAG 1 cut(s) 473
BstAPI GCANNNNNTGC 2 cut(s) 346, 1885
BstAUI TGTACA 2 cut(s) 277, 480
BstC8I GCNNGC 6 cut(s) 347, 1210, 1236, 1257, 1572, 2506
BstDEI CTNAG 5 cut(s) 114, 448, 549, 1379, 2192
BstEII GGTNACC 1 cut(s) 2423
BstENI CCTNNNNNAGG 1 cut(s) 996
BstF5I GGATG 7 cut(s) 437, 886, 1547, 1764, 1768, 1988, 2251
BstH2I RGCGCY 1 cut(s) 2381
BstHHI GCGC 1 cut(s) 2380
BstMAI GTCTC 1 cut(s) 628
BstNI CCWGG 3 cut(s) 366, 1131, 2105
BstNSI RCATGY 5 cut(s) 539, 1238, 1259, 2314, 2390
BstPI GGTNACC 1 cut(s) 2423
BstSCI CCNGG 3 cut(s) 364, 1129, 2103
BstSFI CTRYAG 5 cut(s) 1105, 1396, 1719, 1734, 2616
BstV1I GCAGC 9 cut(s) 349, 1032, 1180, 1413, 1801, 2177, 2367, 2520, 2560
BstX2I RGATCY 2 cut(s) 1503, 2098
BstXI CCANNNNNNTGG 1 cut(s) 568
BstYI RGATCY 2 cut(s) 1503, 2098
BstZ17I GTATAC 1 cut(s) 1149
Bsu36I CCTNAGG 1 cut(s) 2192
BsuRI GGCC 3 cut(s) 802, 1134, 1208
BtsCI GGATG 7 cut(s) 437, 886, 1547, 1764, 1768, 1988, 2251
BtsI GCAGTG 2 cut(s) 199, 2499
BtsIMutI CAGTG 6 cut(s) 180, 199, 720, 754, 1099, 2499
Cac8I GCNNGC 6 cut(s) 347, 1210, 1236, 1257, 1572, 2506
CaiI CAGNNNCTG 1 cut(s) 2191
CciI TCATGA 4 cut(s) 489, 540, 727, 2623
CfoI GCGC 1 cut(s) 2380
Cfr13I GGNCC 1 cut(s) 572
CspCI CAANNNNNGTGG 2 cut(s) 1780, 1815
DdeI CTNAG 5 cut(s) 114, 448, 549, 1379, 2192
Eam1104I CTCTTC 4 cut(s) 1698, 1832, 2192, 2622
EarI CTCTTC 4 cut(s) 1698, 1832, 2192, 2622
Eco130I CCWWGG 4 cut(s) 1728, 1776, 1894, 1969
Eco24I GRGCYC 1 cut(s) 2410
Eco31I GGTCTC 1 cut(s) 628
Eco32I GATATC 1 cut(s) 2256
Eco47I GGWCC 1 cut(s) 572
Eco47III AGCGCT 1 cut(s) 2379
Eco57I CTGAAG 6 cut(s) 51, 87, 1290, 1518, 1869, 2075
Eco81I CCTNAGG 1 cut(s) 2192
Eco88I CYCGRG 2 cut(s) 804, 1180
Eco91I GGTNACC 1 cut(s) 2423
EcoNI CCTNNNNNAGG 1 cut(s) 996
EcoO65I GGTNACC 1 cut(s) 2423
EcoRI GAATTC 1 cut(s) 493
EcoRII CCWGG 3 cut(s) 364, 1129, 2103
EcoRV GATATC 1 cut(s) 2256
EcoT14I CCWWGG 4 cut(s) 1728, 1776, 1894, 1969
EcoT22I ATGCAT 3 cut(s) 1257, 1881, 2392
EcoT38I GRGCYC 1 cut(s) 2410
ErhI CCWWGG 4 cut(s) 1728, 1776, 1894, 1969
FalI AAGNNNNNCTT 6 cut(s) 291, 323, 447, 479, 1760, 1792
FaqI GGGAC 5 cut(s) 272, 585, 1015, 2216, 2597
FauNDI CATATG 2 cut(s) 2392, 2602
FbaI TGATCA 1 cut(s) 223
FblI GTMKAC 3 cut(s) 1148, 1718, 2518
FokI GGATG 7 cut(s) 424, 893, 1554, 1771, 1775, 1995, 2258
FriOI GRGCYC 1 cut(s) 2410
FspBI CTAG 2 cut(s) 501, 636
GlaI GCGC 1 cut(s) 2379
GsaI CCCAGC 1 cut(s) 259
GsuI CTGGAG 1 cut(s) 2087
HaeII RGCGCY 1 cut(s) 2381
HaeIII GGCC 3 cut(s) 802, 1134, 1208
HhaI GCGC 1 cut(s) 2380
Hin6I GCGC 1 cut(s) 2378
HinP1I GCGC 1 cut(s) 2378
HincII GTYRAC 1 cut(s) 120
HindII GTYRAC 1 cut(s) 120
HindIII AAGCTT 2 cut(s) 5, 416
HinfI GANTC 9 cut(s) 116, 160, 393, 404, 892, 918, 1583, 1600, 1640
HphI GGTGA 3 cut(s) 878, 971, 2435
Hpy166II GTNNAC 9 cut(s) 120, 461, 615, 701, 1149, 1719, 1938, 1966, 2519
Hpy188I TCNGA 9 cut(s) 159, 403, 431, 796, 838, 1270, 1687, 2055, 2360
Hpy8I GTNNAC 9 cut(s) 120, 461, 615, 701, 1149, 1719, 1938, 1966, 2519
HpyCH4III ACNGT 9 cut(s) 644, 758, 1054, 1106, 1345, 1467, 1565, 2523, 2620
HpyF3I CTNAG 5 cut(s) 114, 448, 549, 1379, 2192
HspAI GCGC 1 cut(s) 2378
Ksp22I TGATCA 1 cut(s) 223
LmnI GCTCC 3 cut(s) 1041, 1378, 1409
Lsp1109I GCAGC 9 cut(s) 349, 1032, 1180, 1413, 1801, 2177, 2367, 2520, 2560
LweI GCATC 5 cut(s) 42, 871, 1532, 1888, 2236
MaeI CTAG 2 cut(s) 501, 636
MboII GAAGA 8 cut(s) 13, 399, 674, 901, 1685, 1780, 1819, 2209
MfeI CAATTG 1 cut(s) 1005
MflI RGATCY 2 cut(s) 1503, 2098
MhlI GDGCHC 3 cut(s) 1046, 1181, 2410
MlyI GAGTC 1 cut(s) 125
MmeI TCCRAC 1 cut(s) 409
Mph1103I ATGCAT 3 cut(s) 1257, 1881, 2392
MroXI GAANNNNTTC 2 cut(s) 8, 1854
MseI TTAA 3 cut(s) 204, 474, 1874
MslI CAYNNNNRTG 5 cut(s) 330, 1801, 1874, 2391, 2415
MspA1I CMGCKG 2 cut(s) 71, 2511
MspCI CTTAAG 1 cut(s) 473
MspR9I CCNGG 3 cut(s) 366, 1131, 2105
MunI CAATTG 1 cut(s) 1005
Mva1269I GAATGC 1 cut(s) 2500
MvaI CCWGG 3 cut(s) 366, 1131, 2105
NdeI CATATG 2 cut(s) 2392, 2602
NlaIV GGNNCC 4 cut(s) 370, 526, 573, 1374
NmuCI GTSAC 4 cut(s) 194, 1054, 1382, 2423
NsiI ATGCAT 3 cut(s) 1257, 1881, 2392
NspI RCATGY 5 cut(s) 539, 1238, 1259, 2314, 2390
PaeI GCATGC 2 cut(s) 1238, 1259
PaeR7I CTCGAG 1 cut(s) 1180
PagI TCATGA 4 cut(s) 489, 540, 727, 2623
PciI ACATGT 1 cut(s) 2310
PctI GAATGC 1 cut(s) 2500
PdmI GAANNNNTTC 2 cut(s) 8, 1854
PfeI GAWTC 8 cut(s) 160, 393, 404, 892, 918, 1583, 1600, 1640
PflMI CCANNNNNTGG 2 cut(s) 2110, 2490
PleI GAGTC 1 cut(s) 124
PpsI GAGTC 1 cut(s) 124
PscI ACATGT 1 cut(s) 2310
Psp6I CCWGG 3 cut(s) 364, 1129, 2103
PspEI GGTNACC 1 cut(s) 2423
PspFI CCCAGC 1 cut(s) 255
PspGI CCWGG 3 cut(s) 364, 1129, 2103
PspN4I GGNNCC 4 cut(s) 370, 526, 573, 1374
PspPI GGNCC 1 cut(s) 572
PsrI GAACNNNNNNTAC 2 cut(s) 596, 628
PstNI CAGNNNCTG 1 cut(s) 2191
PsuI RGATCY 2 cut(s) 1503, 2098
PvuII CAGCTG 1 cut(s) 71
RseI CAYNNNNRTG 5 cut(s) 330, 1801, 1874, 2391, 2415
SaqAI TTAA 3 cut(s) 204, 474, 1874
Sau96I GGNCC 1 cut(s) 572
ScaI AGTACT 1 cut(s) 2441
SchI GAGTC 1 cut(s) 125
ScrFI CCNGG 3 cut(s) 366, 1131, 2105
SduI GDGCHC 3 cut(s) 1046, 1181, 2410
SfaNI GCATC 5 cut(s) 42, 871, 1532, 1888, 2236
SfcI CTRYAG 5 cut(s) 1105, 1396, 1719, 1734, 2616
Sfr274I CTCGAG 1 cut(s) 1180
SinI GGWCC 1 cut(s) 572
SlaI CTCGAG 1 cut(s) 1180
SmiMI CAYNNNNRTG 5 cut(s) 330, 1801, 1874, 2391, 2415
SmlI CTYRAG 4 cut(s) 308, 473, 982, 1180
SmoI CTYRAG 4 cut(s) 308, 473, 982, 1180
SpeI ACTAGT 1 cut(s) 500
SphI GCATGC 2 cut(s) 1238, 1259
SsiI CCGC 4 cut(s) 1546, 1977, 2465, 2511
SspI AATATT 2 cut(s) 746, 1414
SspMI CTAG 2 cut(s) 501, 636
StyD4I CCNGG 3 cut(s) 364, 1129, 2103
StyI CCWWGG 4 cut(s) 1728, 1776, 1894, 1969
TaaI ACNGT 9 cut(s) 644, 758, 1054, 1106, 1345, 1467, 1565, 2523, 2620
TaqI TCGA 6 cut(s) 50, 531, 916, 1181, 1927, 2578
TaqII GACCGA 1 cut(s) 1346
TatI WGTACW 5 cut(s) 277, 480, 612, 851, 2439
TauI GCSGC 2 cut(s) 1548, 2468
TfiI GAWTC 8 cut(s) 160, 393, 404, 892, 918, 1583, 1600, 1640
Tru1I TTAA 3 cut(s) 204, 474, 1874
Tru9I TTAA 3 cut(s) 204, 474, 1874
TscAI CASTG 6 cut(s) 187, 199, 720, 761, 1099, 2506
TseFI GTSAC 4 cut(s) 194, 1054, 1382, 2423
TseI GCWGC 9 cut(s) 337, 1020, 1193, 1401, 1814, 2165, 2380, 2508, 2548
Tsp45I GTSAC 4 cut(s) 194, 1054, 1382, 2423
TspDTI ATGAA 8 cut(s) 17, 506, 617, 942, 1237, 1494, 1685, 2612
TspGWI ACGGA 1 cut(s) 361
TspRI CASTG 6 cut(s) 187, 199, 720, 761, 1099, 2506
Van91I CCANNNNNTGG 2 cut(s) 2110, 2490
Vha464I CTTAAG 1 cut(s) 473
VpaK11BI GGWCC 1 cut(s) 572
XagI CCTNNNNNAGG 1 cut(s) 996
XapI RAATTY 7 cut(s) 78, 235, 493, 934, 1264, 1921, 2298
XceI RCATGY 5 cut(s) 539, 1238, 1259, 2314, 2390
XcmI CCANNNNNNNNNTGG 1 cut(s) 1024
XhoI CTCGAG 1 cut(s) 1180
XmiI GTMKAC 3 cut(s) 1148, 1718, 2518
XmnI GAANNNNTTC 2 cut(s) 8, 1854
XspI CTAG 2 cut(s) 501, 636
ZrmI AGTACT 1 cut(s) 2441
Zsp2I ATGCAT 3 cut(s) 1257, 1881, 2392
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.