Rh2BG521900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0000576
Physical Location & Seq
Reverse (-)
73229680 .. 73230057
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG521900.1

Sequence Viewer

Length: 378 bp
ATGGGTCCAAGGGACGATGGTGCATCTACTATAAGTGTTGATATTTGGTGTGCCGCCATCGTGGAAAGTGTGCTGCTTTGCTCGGACTCGGGGACTGCTGCTCTGGATGGCGGTGCTCTTGGGTATAATGGCTGCAAGTGTGGTGGCAAGGGCGGCTGTCAAATTGTATTGACTACTAGAGGTAAGGACGACCTTGCTTTCCTCGGGCCTAGACCCTTCGTTGGCAGGGATGACAGCTTGGTTCTACTCGACGGTGGCTGGTACAACGGCGGGATGTACAACATCGGTGGTGGTGGCGGCGGCTTGCAAATTGGAGACGATGGTAGGCTGGAACAGGGGGGTGGAGTCTCTGGGGTGTCCTTAGCAATCTCTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

12.37

Weight (kDa)

4.25

Isoelectric Point (pI)

27.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 6 cut(s) 54, 111, 153, 270, 297, 300
AfaI GTAC 2 cut(s) 263, 278
AfiI CCNNNNNNNGG 1 cut(s) 221
AluBI AGCT 1 cut(s) 237
AluI AGCT 1 cut(s) 237
Alw21I GWGCWC 1 cut(s) 118
Alw26I GTCTC 2 cut(s) 309, 352
Ama87I CYCGRG 2 cut(s) 88, 203
AoxI GGCC 1 cut(s) 206
ApeKI GCWGC 3 cut(s) 73, 98, 132
AspS9I GGNCC 2 cut(s) 5, 206
AvaI CYCGRG 2 cut(s) 88, 203
AvaII GGWCC 1 cut(s) 5
Bbv12I GWGCWC 1 cut(s) 118
BbvI GCAGC 3 cut(s) 60, 85, 119
BccI CCATC 4 cut(s) 11, 65, 101, 314
BceAI ACGGC 1 cut(s) 283
BcoDI GTCTC 2 cut(s) 309, 352
BfaI CTAG 2 cut(s) 177, 210
BisI GCNGC 7 cut(s) 54, 74, 99, 133, 154, 298, 301
BlsI GCNGC 7 cut(s) 55, 75, 100, 134, 155, 299, 302
Bme18I GGWCC 1 cut(s) 5
BmeT110I CYCGRG 2 cut(s) 88, 203
BmgT120I GGNCC 2 cut(s) 5, 206
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 1 cut(s) 32
Bpu10I CCTNAGC 1 cut(s) 361
BsaJI CCNNGG 2 cut(s) 8, 202
Bsc4I CCNNNNNNNGG 1 cut(s) 221
BseDI CCNNGG 2 cut(s) 8, 202
BseGI GGATG 3 cut(s) 112, 235, 279
BseLI CCNNNNNNNGG 1 cut(s) 221
BseXI GCAGC 3 cut(s) 60, 85, 119
BshFI GGCC 1 cut(s) 208
BsiHKAI GWGCWC 1 cut(s) 118
BsiHKCI CYCGRG 2 cut(s) 88, 203
BslFI GGGAC 2 cut(s) 26, 106
BslI CCNNNNNNNGG 1 cut(s) 221
BsmAI GTCTC 2 cut(s) 309, 352
BsmBI CGTCTC 1 cut(s) 309
BsmFI GGGAC 2 cut(s) 26, 106
BsnI GGCC 1 cut(s) 208
BsoBI CYCGRG 2 cut(s) 88, 203
Bsp1286I GDGCHC 1 cut(s) 118
Bsp1407I TGTACA 1 cut(s) 276
BspACI CCGC 6 cut(s) 54, 111, 153, 270, 297, 300
BspANI GGCC 1 cut(s) 208
BspLI GGNNCC 1 cut(s) 6
BsrGI TGTACA 1 cut(s) 276
BssECI CCNNGG 2 cut(s) 8, 202
BssT1I CCWWGG 1 cut(s) 8
Bst4CI ACNGT 1 cut(s) 254
BstAPI GCANNNNNTGC 1 cut(s) 371
BstAUI TGTACA 1 cut(s) 276
BstC8I GCNNGC 1 cut(s) 305
BstDEI CTNAG 2 cut(s) 361, 375
BstF5I GGATG 3 cut(s) 112, 235, 279
BstMAI GTCTC 2 cut(s) 309, 352
BstMWI GCNNNNNNNGC 2 cut(s) 153, 371
BstV1I GCAGC 3 cut(s) 60, 85, 119
BsuRI GGCC 1 cut(s) 208
BtsCI GGATG 3 cut(s) 112, 235, 279
Cac8I GCNNGC 1 cut(s) 305
Cfr13I GGNCC 2 cut(s) 5, 206
Csp6I GTAC 2 cut(s) 262, 277
CspCI CAANNNNNGTGG 4 cut(s) 124, 159, 268, 303
CviJI RGCY 7 cut(s) 132, 156, 208, 237, 258, 303, 328
CviKI_1 RGCY 7 cut(s) 132, 156, 208, 237, 258, 303, 328
CviQI GTAC 2 cut(s) 262, 277
DdeI CTNAG 2 cut(s) 361, 375
Eco130I CCWWGG 1 cut(s) 8
Eco47I GGWCC 1 cut(s) 5
Eco88I CYCGRG 2 cut(s) 88, 203
EcoT14I CCWWGG 1 cut(s) 8
ErhI CCWWGG 1 cut(s) 8
Esp3I CGTCTC 1 cut(s) 309
FaiI YATR 2 cut(s) 32, 126
FaqI GGGAC 2 cut(s) 26, 106
FauI CCCGC 1 cut(s) 263
Fnu4HI GCNGC 7 cut(s) 54, 74, 99, 133, 154, 298, 301
FokI GGATG 3 cut(s) 119, 242, 286
Fsp4HI GCNGC 7 cut(s) 54, 74, 99, 133, 154, 298, 301
FspBI CTAG 2 cut(s) 177, 210
GluI GCNGC 7 cut(s) 54, 74, 99, 133, 154, 298, 301
HaeIII GGCC 1 cut(s) 208
HinfI GANTC 2 cut(s) 86, 345
Hpy188I TCNGA 1 cut(s) 85
Hpy188III TCNNGA 1 cut(s) 104
Hpy99I CGWCG 1 cut(s) 254
HpyAV CCTTC 1 cut(s) 226
HpyCH4III ACNGT 1 cut(s) 254
HpyCH4V TGCA 3 cut(s) 23, 135, 307
HpyF10VI GCNNNNNNNGC 2 cut(s) 153, 371
HpyF3I CTNAG 2 cut(s) 361, 375
LpnPI CCDG 6 cut(s) 89, 211, 244, 314, 320, 336
Lsp1109I GCAGC 3 cut(s) 60, 85, 119
LweI GCATC 1 cut(s) 32
MaeI CTAG 2 cut(s) 177, 210
MhlI GDGCHC 1 cut(s) 118
MluCI AATT 2 cut(s) 162, 309
MlyI GAGTC 2 cut(s) 80, 354
MnlI CCTC 2 cut(s) 173, 212
MwoI GCNNNNNNNGC 2 cut(s) 153, 371
NlaIV GGNNCC 1 cut(s) 6
PkrI GCNGC 7 cut(s) 55, 75, 100, 134, 155, 299, 302
PleI GAGTC 2 cut(s) 80, 353
PpsI GAGTC 2 cut(s) 80, 353
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 2 cut(s) 5, 206
RsaI GTAC 2 cut(s) 263, 278
RsaNI GTAC 2 cut(s) 262, 277
SatI GCNGC 7 cut(s) 54, 74, 99, 133, 154, 298, 301
Sau96I GGNCC 2 cut(s) 5, 206
SchI GAGTC 2 cut(s) 80, 354
SduI GDGCHC 1 cut(s) 118
SetI ASST 3 cut(s) 184, 195, 239
SfaNI GCATC 1 cut(s) 32
SinI GGWCC 1 cut(s) 5
Sse9I AATT 2 cut(s) 162, 309
SsiI CCGC 6 cut(s) 54, 111, 153, 270, 297, 300
SspMI CTAG 2 cut(s) 177, 210
StyI CCWWGG 1 cut(s) 8
TaaI ACNGT 1 cut(s) 254
TaqI TCGA 1 cut(s) 249
TasI AATT 2 cut(s) 162, 309
TatI WGTACW 1 cut(s) 276
TauI GCSGC 4 cut(s) 56, 156, 300, 303
TseI GCWGC 3 cut(s) 73, 98, 132
VpaK11BI GGWCC 1 cut(s) 5
XspI CTAG 2 cut(s) 177, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.