Rh5BG490300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0000576
Physical Location & Seq
Reverse (-)
78047053 .. 78047409
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG490300.1

Sequence Viewer

Length: 357 bp
ATGTTGGTGTCGAGGGTTGGGGGCGTTGTTGGATCAGCGTCCAAGCTCGACGGTAAAGTGCAAGATGCTACCTCGTTTGCAGGGATGGCATCTCGGTGGCGGGTGAGTGGTGATCCGGTCTTGGTTTGGTCAAGATCAGATCGGAAAGGTCTATTCCGATTGGATCCAAGGGACGATGGTGCATCTAAGAATGGCATCTTGATTAACCAAATCTGGTTTGGTGTTCCTATTGATAGTGATAATGGATCTACTCTTGATCCGTCAATCTATGGCGGAGGCCAGGTTACTCTTGTTGGAGGTGGTGGTGATCTATGGTGGGGTTGCGTGCAACCTGAGTGGCGAATCTGGGCGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

12.69

Weight (kDa)

7.9

Isoelectric Point (pI)

28.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 100, 273
AclWI GGATC 6 cut(s) 40, 107, 158, 171, 251, 253
AjnI CCWGG 1 cut(s) 279
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
AlwI GGATC 6 cut(s) 40, 107, 158, 171, 251, 253
AoxI GGCC 1 cut(s) 277
AsuHPI GGTGA 3 cut(s) 115, 122, 317
BamHI GGATCC 1 cut(s) 163
BccI CCATC 2 cut(s) 79, 170
BciT130I CCWGG 1 cut(s) 281
Bme1390I CCNGG 1 cut(s) 281
BmiI GGNNCC 1 cut(s) 165
BmrFI CCNGG 1 cut(s) 281
BmsI GCATC 4 cut(s) 55, 98, 191, 204
BsaJI CCNNGG 1 cut(s) 167
BsaWI WCCGGW 1 cut(s) 115
BsaXI ACNNNNNCTCC 2 cut(s) 267, 297
BseBI CCWGG 1 cut(s) 281
BseDI CCNNGG 1 cut(s) 167
BseGI GGATG 1 cut(s) 90
BseMII CTCAG 1 cut(s) 324
BshFI GGCC 1 cut(s) 279
BsiSI CCGG 1 cut(s) 116
BslFI GGGAC 1 cut(s) 185
BsmFI GGGAC 1 cut(s) 185
BsnI GGCC 1 cut(s) 279
Bsp143I GATC 8 cut(s) 32, 112, 134, 139, 163, 245, 256, 307
BspACI CCGC 2 cut(s) 100, 273
BspANI GGCC 1 cut(s) 279
BspCNI CTCAG 1 cut(s) 325
BspLI GGNNCC 1 cut(s) 165
BspPI GGATC 6 cut(s) 40, 107, 158, 171, 251, 253
BssECI CCNNGG 1 cut(s) 167
BssMI GATC 8 cut(s) 32, 112, 134, 139, 163, 245, 256, 307
BssT1I CCWWGG 1 cut(s) 167
Bst2UI CCWGG 1 cut(s) 281
Bst4CI ACNGT 1 cut(s) 53
BstC8I GCNNGC 1 cut(s) 326
BstDEI CTNAG 2 cut(s) 186, 333
BstF5I GGATG 1 cut(s) 90
BstKTI GATC 8 cut(s) 35, 115, 137, 142, 166, 248, 259, 310
BstMBI GATC 8 cut(s) 32, 112, 134, 139, 163, 245, 256, 307
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstNI CCWGG 1 cut(s) 281
BstSCI CCNGG 1 cut(s) 279
BstX2I RGATCY 2 cut(s) 163, 245
BstYI RGATCY 2 cut(s) 163, 245
BsuRI GGCC 1 cut(s) 279
BtsCI GGATG 1 cut(s) 90
Cac8I GCNNGC 1 cut(s) 326
CseI GACGC 1 cut(s) 27
CspCI CAANNNNNGTGG 2 cut(s) 317, 352
CviJI RGCY 2 cut(s) 46, 279
CviKI_1 RGCY 2 cut(s) 46, 279
DdeI CTNAG 2 cut(s) 186, 333
DpnI GATC 8 cut(s) 34, 114, 136, 141, 165, 247, 258, 309
DpnII GATC 8 cut(s) 32, 112, 134, 139, 163, 245, 256, 307
EciI GGCGGA 1 cut(s) 288
Eco130I CCWWGG 1 cut(s) 167
EcoRII CCWGG 1 cut(s) 279
EcoT14I CCWWGG 1 cut(s) 167
ErhI CCWWGG 1 cut(s) 167
FaiI YATR 2 cut(s) 270, 313
FaqI GGGAC 1 cut(s) 185
FauI CCCGC 1 cut(s) 93
FokI GGATG 1 cut(s) 97
HaeIII GGCC 1 cut(s) 279
HapII CCGG 1 cut(s) 116
HgaI GACGC 1 cut(s) 27
HinfI GANTC 1 cut(s) 342
HpaII CCGG 1 cut(s) 116
HphI GGTGA 3 cut(s) 115, 122, 317
Hpy188I TCNGA 3 cut(s) 139, 144, 158
Hpy188III TCNNGA 3 cut(s) 132, 199, 254
Hpy99I CGWCG 1 cut(s) 53
HpyCH4III ACNGT 1 cut(s) 53
HpyCH4V TGCA 4 cut(s) 61, 80, 182, 328
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 2 cut(s) 186, 333
Kzo9I GATC 8 cut(s) 32, 112, 134, 139, 163, 245, 256, 307
LpnPI CCDG 7 cut(s) 66, 129, 199, 266, 293, 331, 345
LweI GCATC 4 cut(s) 55, 98, 191, 204
MaeIII GTNAC 1 cut(s) 283
MalI GATC 8 cut(s) 34, 114, 136, 141, 165, 247, 258, 309
MboI GATC 8 cut(s) 32, 112, 134, 139, 163, 245, 256, 307
MflI RGATCY 2 cut(s) 163, 245
MmeI TCCRAC 2 cut(s) 10, 274
MnlI CCTC 5 cut(s) 6, 82, 269, 290, 345
MseI TTAA 1 cut(s) 204
MslI CAYNNNNRTG 1 cut(s) 94
MspI CCGG 1 cut(s) 116
MspR9I CCNGG 1 cut(s) 281
MvaI CCWGG 1 cut(s) 281
MwoI GCNNNNNNNGC 1 cut(s) 86
NdeII GATC 8 cut(s) 32, 112, 134, 139, 163, 245, 256, 307
NlaIV GGNNCC 1 cut(s) 165
PfeI GAWTC 1 cut(s) 342
Psp6I CCWGG 1 cut(s) 279
PspGI CCWGG 1 cut(s) 279
PspN4I GGNNCC 1 cut(s) 165
PsuI RGATCY 2 cut(s) 163, 245
RseI CAYNNNNRTG 1 cut(s) 94
SaqAI TTAA 1 cut(s) 204
Sau3AI GATC 8 cut(s) 32, 112, 134, 139, 163, 245, 256, 307
ScrFI CCNGG 1 cut(s) 281
SetI ASST 7 cut(s) 48, 74, 151, 285, 301, 334, 356
SfaNI GCATC 4 cut(s) 55, 98, 191, 204
SmiMI CAYNNNNRTG 1 cut(s) 94
SsiI CCGC 2 cut(s) 100, 273
StyD4I CCNGG 1 cut(s) 279
StyI CCWWGG 1 cut(s) 167
TaaI ACNGT 1 cut(s) 53
TaqI TCGA 2 cut(s) 11, 48
TfiI GAWTC 1 cut(s) 342
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TspGWI ACGGA 1 cut(s) 249
XcmI CCANNNNNNNNNTGG 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.