Rh3BG110000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0000576
Physical Location & Seq
Forward (+)
8913701 .. 8914874
1174 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG110000.1

Sequence Viewer

Length: 372 bp
ATGAATCTGGTTCTAGGTCTGCTTATTATATTCTTCATTGCGCTGGGTGGCACTGAAGCTATGTTGATTTCGTGGGACGGGGGCGCGGTTGTTTTTGCGTCCAAGCCCGATGGTGAAGTGAAAGATGCGGCCTCGTTTGTAGGGATGGCATCTAGGTGGCAGATGAGCGGCGATCAGATCTTGGGTTGGTCTAGATCTATTTGGAAGGTTCGTTTCCTATCACGTGCTGATTTTTGGAGTGCTGGTGATCTTGTTGTCGTGGAGGGTGATGATGTGATGGTTTGCTCGACCTCAAGGACTGCTACTGCTGATGGTGGTCCGAGGCTGCCGGAGGTGAGGCCGGCTTTGCTTCCCTTTGACTTGGACCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

123

Amino Acids

13.25

Weight (kDa)

4.48

Isoelectric Point (pI)

38.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 168
AccII CGCG 1 cut(s) 86
AciI CCGC 3 cut(s) 86, 128, 168
AcuI CTGAAG 1 cut(s) 75
AcvI CACGTG 1 cut(s) 224
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
AoxI GGCC 2 cut(s) 129, 338
ApeKI GCWGC 1 cut(s) 325
AspLEI GCGC 2 cut(s) 43, 86
AspS9I GGNCC 2 cut(s) 317, 364
AsuHPI GGTGA 4 cut(s) 125, 257, 278, 346
AvaII GGWCC 2 cut(s) 317, 364
BbrPI CACGTG 1 cut(s) 224
BbvI GCAGC 1 cut(s) 312
BccI CCATC 4 cut(s) 104, 139, 271, 305
BfaI CTAG 3 cut(s) 14, 153, 192
BglII AGATCT 2 cut(s) 177, 194
BisI GCNGC 3 cut(s) 129, 169, 326
BlsI GCNGC 3 cut(s) 130, 170, 327
Bme18I GGWCC 2 cut(s) 317, 364
BmgT120I GGNCC 2 cut(s) 317, 364
BmiI GGNNCC 1 cut(s) 366
BmsI GCATC 2 cut(s) 115, 158
BpuEI CTTGAG 1 cut(s) 277
BsaAI YACGTR 1 cut(s) 224
BsaJI CCNNGG 1 cut(s) 320
BsaXI ACNNNNNCTCC 2 cut(s) 229, 259
Bse118I RCCGGY 1 cut(s) 340
Bse3DI GCAATG 1 cut(s) 36
BseDI CCNNGG 1 cut(s) 320
BseGI GGATG 1 cut(s) 150
BseMI GCAATG 1 cut(s) 36
BseXI GCAGC 1 cut(s) 312
BseYI CCCAGC 1 cut(s) 43
Bsh1236I CGCG 1 cut(s) 86
BshFI GGCC 2 cut(s) 131, 340
BsiSI CCGG 2 cut(s) 329, 341
BslFI GGGAC 1 cut(s) 89
BsmFI GGGAC 1 cut(s) 89
BsnI GGCC 2 cut(s) 131, 340
Bsp143I GATC 4 cut(s) 172, 177, 194, 247
BspACI CCGC 3 cut(s) 86, 128, 168
BspANI GGCC 2 cut(s) 131, 340
BspFNI CGCG 1 cut(s) 86
BspLI GGNNCC 1 cut(s) 366
BsrBI CCGCTC 1 cut(s) 168
BsrDI GCAATG 1 cut(s) 36
BsrFI RCCGGY 1 cut(s) 340
BssAI RCCGGY 1 cut(s) 340
BssECI CCNNGG 1 cut(s) 320
BssMI GATC 4 cut(s) 172, 177, 194, 247
BstBAI YACGTR 1 cut(s) 224
BstC8I GCNNGC 1 cut(s) 342
BstDEI CTNAG 1 cut(s) 369
BstF5I GGATG 1 cut(s) 150
BstFNI CGCG 1 cut(s) 86
BstHHI GCGC 2 cut(s) 43, 86
BstKTI GATC 4 cut(s) 175, 180, 197, 250
BstMBI GATC 4 cut(s) 172, 177, 194, 247
BstMWI GCNNNNNNNGC 1 cut(s) 346
BstUI CGCG 1 cut(s) 86
BstV1I GCAGC 1 cut(s) 312
BstX2I RGATCY 2 cut(s) 177, 194
BstYI RGATCY 2 cut(s) 177, 194
BsuRI GGCC 2 cut(s) 131, 340
BtsCI GGATG 1 cut(s) 150
BtsIMutI CAGTG 1 cut(s) 51
Cac8I GCNNGC 1 cut(s) 342
CfoI GCGC 2 cut(s) 43, 86
Cfr10I RCCGGY 1 cut(s) 340
Cfr13I GGNCC 2 cut(s) 317, 364
CseI GACGC 1 cut(s) 87
CviJI RGCY 6 cut(s) 59, 106, 131, 325, 340, 344
CviKI_1 RGCY 6 cut(s) 59, 106, 131, 325, 340, 344
DdeI CTNAG 1 cut(s) 369
DpnI GATC 4 cut(s) 174, 179, 196, 249
DpnII GATC 4 cut(s) 172, 177, 194, 247
Eco47I GGWCC 2 cut(s) 317, 364
Eco57I CTGAAG 1 cut(s) 75
Eco72I CACGTG 1 cut(s) 224
FaiI YATR 2 cut(s) 29, 62
FaqI GGGAC 1 cut(s) 89
Fnu4HI GCNGC 3 cut(s) 129, 169, 326
FokI GGATG 1 cut(s) 157
Fsp4HI GCNGC 3 cut(s) 129, 169, 326
FspBI CTAG 3 cut(s) 14, 153, 192
GlaI GCGC 2 cut(s) 42, 85
GluI GCNGC 3 cut(s) 129, 169, 326
GsaI CCCAGC 1 cut(s) 47
HaeIII GGCC 2 cut(s) 131, 340
HapII CCGG 2 cut(s) 329, 341
HgaI GACGC 1 cut(s) 87
HhaI GCGC 2 cut(s) 43, 86
Hin6I GCGC 2 cut(s) 41, 84
HinP1I GCGC 2 cut(s) 41, 84
HinfI GANTC 1 cut(s) 4
HpaII CCGG 2 cut(s) 329, 341
HphI GGTGA 4 cut(s) 125, 257, 278, 346
Hpy188I TCNGA 2 cut(s) 177, 321
Hpy188III TCNNGA 1 cut(s) 192
HpyAV CCTTC 1 cut(s) 199
HpyCH4IV ACGT 1 cut(s) 223
HpyF10VI GCNNNNNNNGC 1 cut(s) 346
HpyF3I CTNAG 1 cut(s) 369
HpySE526I ACGT 1 cut(s) 223
HspAI GCGC 2 cut(s) 41, 84
KroI GCCGGC 1 cut(s) 340
KroNI GCCGGC 1 cut(s) 342
Kzo9I GATC 4 cut(s) 172, 177, 194, 247
LpnPI CCDG 4 cut(s) 29, 228, 342, 354
Lsp1109I GCAGC 1 cut(s) 312
LweI GCATC 2 cut(s) 115, 158
MaeI CTAG 3 cut(s) 14, 153, 192
MaeII ACGT 1 cut(s) 223
MalI GATC 4 cut(s) 174, 179, 196, 249
MbiI CCGCTC 1 cut(s) 168
MboI GATC 4 cut(s) 172, 177, 194, 247
MboII GAAGA 1 cut(s) 25
MflI RGATCY 2 cut(s) 177, 194
MnlI CCTC 6 cut(s) 142, 256, 301, 315, 325, 330
MroNI GCCGGC 1 cut(s) 340
MslI CAYNNNNRTG 1 cut(s) 154
MspI CCGG 2 cut(s) 329, 341
MvnI CGCG 1 cut(s) 86
MwoI GCNNNNNNNGC 1 cut(s) 346
NaeI GCCGGC 1 cut(s) 342
NdeII GATC 4 cut(s) 172, 177, 194, 247
NgoMIV GCCGGC 1 cut(s) 340
NlaIV GGNNCC 1 cut(s) 366
PdiI GCCGGC 1 cut(s) 342
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 3 cut(s) 130, 170, 327
PmaCI CACGTG 1 cut(s) 224
PmlI CACGTG 1 cut(s) 224
Ppu21I YACGTR 1 cut(s) 224
PspCI CACGTG 1 cut(s) 224
PspFI CCCAGC 1 cut(s) 43
PspN4I GGNNCC 1 cut(s) 366
PspPI GGNCC 2 cut(s) 317, 364
PsuI RGATCY 2 cut(s) 177, 194
RseI CAYNNNNRTG 1 cut(s) 154
SatI GCNGC 3 cut(s) 129, 169, 326
Sau3AI GATC 4 cut(s) 172, 177, 194, 247
Sau96I GGNCC 2 cut(s) 317, 364
SetI ASST 7 cut(s) 19, 61, 158, 210, 226, 293, 336
SfaNI GCATC 2 cut(s) 115, 158
SinI GGWCC 2 cut(s) 317, 364
SmiMI CAYNNNNRTG 1 cut(s) 154
SmlI CTYRAG 1 cut(s) 292
SmoI CTYRAG 1 cut(s) 292
SsiI CCGC 3 cut(s) 86, 128, 168
SspMI CTAG 3 cut(s) 14, 153, 192
TaiI ACGT 1 cut(s) 226
TaqI TCGA 1 cut(s) 287
TauI GCSGC 2 cut(s) 131, 171
TfiI GAWTC 1 cut(s) 4
TscAI CASTG 1 cut(s) 58
TseI GCWGC 1 cut(s) 325
TspDTI ATGAA 2 cut(s) 17, 25
TspRI CASTG 1 cut(s) 58
VpaK11BI GGWCC 2 cut(s) 317, 364
XbaI TCTAGA 1 cut(s) 191
XspI CTAG 3 cut(s) 14, 153, 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.