Rh1AG006500

U-box domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
938243 .. 938801
559 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG006500.1

Sequence Viewer

Length: 333 bp
ATGAGGATGAGCTACCGGCAAGCTAGAGAATCAGAGAGCACTCGTTACCACCCCCCTAGCAAGCCAGATGACTTTGAAATCAAGCCACCATTCACAAGAGGAAACTTGGCAATGAACAAGTCATATCAGATCTCATCAGAAGCTGATATATCATACGTCGGTAGTGGCAAGCCAAACATGGATAACATGTTTCCTTGTTTCTATGATGGTTTAGAATCAGGAATTAGCCCTCACTCACAGTGGGAGAACAGAAGATCCACGTCGACAACTTACTCAGGAAATAAGTTTATTGAGATGAGCTCAGCACAAAATGAATTTTCCTCCTTCAATTGA

Protein Analysis

110

Amino Acids

12.6

Weight (kDa)

6.08

Isoelectric Point (pI)

60.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000353)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G07020 AT5G35380
fragaria_vesca FvH4_1g27800 FvH4_1g27800 FvH4_1g27800 FvH4_1g27800 FvH4_1g27800 FvH4_6g28460 FvH4_6g29380 FvH4_6g29380 FvH4_6g29380 FvH4_6g29380 FvH4_6g29580 FvH4_6g29580 FvH4_6g29581
malus_domestica MD02G1258200.v1.1 MD09G1226500.v1.1 MD13G1232900.v1.1 MD13G1233000.v1.1 MD17G1212900.v1.1 MD17G1215300.v1.1 MD17G1215400.v1.1 MD17G1224800.v1.1
prunus_persica Prupe.1G064300_v2.0.a1 Prupe.2G073500_v2.0.a1 Prupe.2G073500_v2.0.a1 Prupe.3G088300_v2.0.a1 Prupe.3G091100_v2.0.a1 Prupe.3G100600_v2.0.a1
pyrus_communis pycom02g21950 pycom09g14550 pycom13g20580 pycom17g21790 pycom17g21970 pycom17g22850
rosa_chinensis RchiOBHm_Chr1g0332091 RchiOBHm_Chr2g0132681 RchiOBHm_Chr2g0134781 RchiOBHm_Chr2g0135161 RchiOBHm_Chr2g0135181 RchiOBHm_Chr2g0135191 RchiOBHm_Chr2g0135201 RchiOBHm_Chr4g0397641 RchiOBHm_Chr4g0397651
rosa_laevigata RLG00000009421 RLG00000019421 RLG00000019446 RLG00000019447 RLG00000029693
rosa_multiflora Rmu_co8345215.1_g000001 Rmu_sc0000100.1_g000004 Rmu_sc0000718.1_g000015 Rmu_sc0002729.1_g000006 Rmu_sc0003358.1_g000008 Rmu_sc0004216.1_g000001 Rmu_sc0013462.1_g000001 Rmu_sc0013462.1_g000002 Rmu_sc0016837.1_g000002 Rmu_sc0021270.1_g000001 Rmu_sc0021634.1_g000001 Rmu_sc0024706.1_g000001
rosa_roxburghii Rroxscaffold_2G00109410 Rroxscaffold_2G00109420 Rroxscaffold_2G00109760 Rroxscaffold_4G00318390 Rroxscaffold_5G00342450 Rroxscaffold_5G00342460
rosa_rugosa Rorug01G0098200 Rorug01G0098300 Rorug02G0306000 Rorug02G0320000 Rorug02G0323800 Rorug02G0323800 Rorug03G0342000 Rorug03G0342100
rosa_samantha Rh1AG006500 Rh1AG122200 Rh1BG093600 Rh1CG116800 Rh2AG359000 Rh2AG371300 Rh2AG371400 Rh2AG373600 Rh2BG365600 Rh2BG377600 Rh2BG380100 Rh2BG380200 Rh2BG380300 Rh2CG342200 Rh2CG356000 Rh2CG359300 Rh2CG359600 Rh2DG382100 Rh2DG394600 Rh2DG396600 Rh2DG396700 Rh2DG396800 Rh2DG396900 Rh4BG077700 Rh4CG085500 Rh4DG072600
rosa_wichuraiana Rw1G009960 Rw2G029220 Rw2G030290 Rw2G030560 Rw2G030570 Rw4G006520

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 263
AclWI GGATC 1 cut(s) 249
AcsI RAATTY 1 cut(s) 314
AflIII ACRYGT 1 cut(s) 186
AgsI TTSAA 2 cut(s) 77, 328
AjiI CACGTC 1 cut(s) 261
AloI GAACNNNNNNTCC 2 cut(s) 239, 271
AluBI AGCT 4 cut(s) 12, 23, 143, 300
AluI AGCT 4 cut(s) 12, 23, 143, 300
Alw21I GWGCWC 2 cut(s) 41, 302
AlwI GGATC 1 cut(s) 249
AlwNI CAGNNNCTG 1 cut(s) 143
ApoI RAATTY 1 cut(s) 314
BanII GRGCYC 1 cut(s) 302
Bbv12I GWGCWC 2 cut(s) 41, 302
BccI CCATC 1 cut(s) 200
BfaI CTAG 2 cut(s) 24, 57
BglII AGATCT 1 cut(s) 129
BlpI GCTNAGC 1 cut(s) 301
BmgBI CACGTC 1 cut(s) 261
BplI GAGNNNNNCTC 2 cut(s) 284, 316
Bpu1102I GCTNAGC 1 cut(s) 301
Bse118I RCCGGY 1 cut(s) 15
Bse3DI GCAATG 1 cut(s) 117
BseGI GGATG 1 cut(s) 12
BseMI GCAATG 1 cut(s) 117
BseMII CTCAG 2 cut(s) 288, 315
BsiHKAI GWGCWC 2 cut(s) 41, 302
BsiSI CCGG 1 cut(s) 16
Bsp1286I GDGCHC 2 cut(s) 41, 302
Bsp143I GATC 2 cut(s) 129, 254
Bsp1720I GCTNAGC 1 cut(s) 301
BspCNI CTCAG 2 cut(s) 287, 314
BspPI GGATC 1 cut(s) 249
BsrDI GCAATG 1 cut(s) 117
BsrFI RCCGGY 1 cut(s) 15
BssAI RCCGGY 1 cut(s) 15
BssMI GATC 2 cut(s) 129, 254
Bst4CI ACNGT 1 cut(s) 240
BstC8I GCNNGC 3 cut(s) 21, 62, 170
BstDEI CTNAG 2 cut(s) 274, 301
BstF5I GGATG 1 cut(s) 12
BstKTI GATC 2 cut(s) 132, 257
BstMBI GATC 2 cut(s) 129, 254
BstNSI RCATGY 1 cut(s) 190
BstX2I RGATCY 2 cut(s) 129, 254
BstYI RGATCY 2 cut(s) 129, 254
BtrI CACGTC 1 cut(s) 261
BtsCI GGATG 1 cut(s) 12
BtsIMutI CAGTG 1 cut(s) 245
Cac8I GCNNGC 3 cut(s) 21, 62, 170
CaiI CAGNNNCTG 1 cut(s) 143
Cfr10I RCCGGY 1 cut(s) 15
CviAII CATG 2 cut(s) 178, 187
CviJI RGCY 8 cut(s) 12, 23, 64, 85, 143, 172, 228, 300
CviKI_1 RGCY 8 cut(s) 12, 23, 64, 85, 143, 172, 228, 300
DdeI CTNAG 2 cut(s) 274, 301
DpnI GATC 2 cut(s) 131, 256
DpnII GATC 2 cut(s) 129, 254
Ecl136II GAGCTC 1 cut(s) 300
Eco24I GRGCYC 1 cut(s) 302
Eco53kI GAGCTC 1 cut(s) 300
EcoICRI GAGCTC 1 cut(s) 300
EcoT38I GRGCYC 1 cut(s) 302
FaeI CATG 2 cut(s) 181, 190
FaiI YATR 6 cut(s) 124, 149, 154, 179, 188, 204
FatI CATG 2 cut(s) 177, 186
FblI GTMKAC 1 cut(s) 263
FokI GGATG 1 cut(s) 19
FriOI GRGCYC 1 cut(s) 302
FspBI CTAG 2 cut(s) 24, 57
HapII CCGG 1 cut(s) 16
Hin1II CATG 2 cut(s) 181, 190
HincII GTYRAC 1 cut(s) 264
HindII GTYRAC 1 cut(s) 264
HinfI GANTC 2 cut(s) 29, 215
HpaII CCGG 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 264
Hpy188I TCNGA 3 cut(s) 34, 129, 139
Hpy188III TCNNGA 2 cut(s) 219, 276
Hpy8I GTNNAC 1 cut(s) 264
Hpy99I CGWCG 2 cut(s) 161, 265
HpyCH4III ACNGT 1 cut(s) 240
HpyCH4IV ACGT 2 cut(s) 156, 260
HpyF3I CTNAG 2 cut(s) 274, 301
HpySE526I ACGT 2 cut(s) 156, 260
Hsp92II CATG 2 cut(s) 181, 190
Kzo9I GATC 2 cut(s) 129, 254
LpnPI CCDG 4 cut(s) 29, 78, 204, 261
MaeI CTAG 2 cut(s) 24, 57
MaeII ACGT 2 cut(s) 156, 260
MaeIII GTNAC 1 cut(s) 44
MalI GATC 2 cut(s) 131, 256
MboI GATC 2 cut(s) 129, 254
MboII GAAGA 1 cut(s) 264
MfeI CAATTG 1 cut(s) 328
MflI RGATCY 2 cut(s) 129, 254
MhlI GDGCHC 2 cut(s) 41, 302
MluCI AATT 3 cut(s) 222, 314, 328
MnlI CCTC 3 cut(s) 92, 240, 331
MspI CCGG 1 cut(s) 16
MunI CAATTG 1 cut(s) 328
NdeII GATC 2 cut(s) 129, 254
NlaIII CATG 2 cut(s) 181, 190
NspI RCATGY 1 cut(s) 190
PciI ACATGT 1 cut(s) 186
PfeI GAWTC 2 cut(s) 29, 215
PscI ACATGT 1 cut(s) 186
Psp124BI GAGCTC 1 cut(s) 302
PstNI CAGNNNCTG 1 cut(s) 143
PsuI RGATCY 2 cut(s) 129, 254
SacI GAGCTC 1 cut(s) 302
SalI GTCGAC 1 cut(s) 262
Sau3AI GATC 2 cut(s) 129, 254
SduI GDGCHC 2 cut(s) 41, 302
SetI ASST 6 cut(s) 14, 25, 145, 159, 263, 302
Sse9I AATT 3 cut(s) 222, 314, 328
SspMI CTAG 2 cut(s) 24, 57
SstI GAGCTC 1 cut(s) 302
TaaI ACNGT 1 cut(s) 240
TaiI ACGT 2 cut(s) 159, 263
TaqI TCGA 1 cut(s) 263
TasI AATT 3 cut(s) 222, 314, 328
TfiI GAWTC 2 cut(s) 29, 215
TscAI CASTG 1 cut(s) 245
TspDTI ATGAA 2 cut(s) 128, 327
TspRI CASTG 1 cut(s) 245
XapI RAATTY 1 cut(s) 314
XceI RCATGY 1 cut(s) 190
XmiI GTMKAC 1 cut(s) 263
XspI CTAG 2 cut(s) 24, 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.