Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr06

Orthogroup ID

OG0000513

Physical Location & Seq

Genomic Coordinates Forward (+)

18610840 .. 18614144

Gene Structure 3305 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD06G1074500.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 225 bp

ATGGATGGAAGGCTAGCTAGGAGGTTCTTCTCCACACATGTCACACTTGCATACAAAACGATTTCCAGTTGCTTTTCGATAAGCTATGAATACTCAACGCCCCAGATTAACCATTGGATGATTGCATACGACAACCCAAAACATTCCCTACAAGTTCCCTACATGAATTGCATAATAGAGATACAAGCAAGAATCATTAAGTTCTATGAAAAACATAAGCATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

75

Amino Acids

8.87

Weight (kDa)

9.26

Isoelectric Point (pI)

56.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000513)

Species	Orthologous Gene IDs
malus_domestica	MD00G1165900.v1.1 MD01G1149400.v1.1 MD02G1188500.v1.1 MD06G1074500.v1.1 MD06G1183900.v1.1 MD08G1220300.v1.1 MD11G1317300.v1.1 MD12G1033900.v1.1 MD13G1075700.v1.1 MD13G1253200.v1.1 MD16G1023900.v1.1
pyrus_communis	pycom01g00140 pycom01g00540 pycom01g00600 pycom01g00660 pycom01g00920 pycom01g00970 pycom01g02740 pycom01g04610 pycom01g10660 pycom01g21320 pycom02g07390 pycom02g17600 pycom02g18670 pycom02g18770 pycom03g02770 pycom03g15990 pycom03g21130 pycom04g16620 pycom04g21450 pycom05g06020 pycom05g08170 pycom05g13560 pycom05g22750 pycom05g23690 pycom05g23730 pycom05g23760 pycom05g23950 pycom05g24030 pycom07g12530 pycom07g12550 pycom08g01040 pycom08g16160 pycom10g03920 pycom11g13260 pycom11g13940 pycom11g16660 pycom12556g00120 pycom12661g00080 pycom12g07880 pycom13g05260 pycom13g11350 pycom13g15930 pycom13g23350 pycom13g23690 pycom13g23750 pycom13g23880 pycom13g24500 pycom13g24620 pycom13g26020 pycom13g26300 pycom13g27320 pycom13g28360 pycom14g12840 pycom15g17240 pycom15g31400 pycom15g32660 pycom16g21180 pycom16g21190 pycom16g22580 pycom16g24640 pycom16g26060 pycom16g26400 pycom16g26410 pycom17g03930 pycom17g16310 pycom17g16320 pycom17g16920 pycom420g00790 pycom520g00370 pycom520g00530 pycom520g00830 pycom520g00840 pycom520g00880 pycom520g00930 pycom808g00600
rosa_chinensis	RchiOBHm_Chr2g0089701

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AflIII	ACRYGT	1 cut(s)	37
AluBI	AGCT	2 cut(s)	17, 84
AluI	AGCT	2 cut(s)	17, 84
AsuNHI	GCTAGC	1 cut(s)	13
BfaI	CTAG	2 cut(s)	14, 18
BmtI	GCTAGC	1 cut(s)	17
Bse1I	ACTGG	1 cut(s)	66
BseGI	GGATG	2 cut(s)	10, 123
BseNI	ACTGG	1 cut(s)	66
BspOI	GCTAGC	1 cut(s)	17
BsrI	ACTGG	1 cut(s)	66
BstC8I	GCNNGC	1 cut(s)	15
BstF5I	GGATG	2 cut(s)	10, 123
BstNSI	RCATGY	1 cut(s)	41
BtsCI	GGATG	2 cut(s)	10, 123
Cac8I	GCNNGC	1 cut(s)	15
CviAII	CATG	2 cut(s)	38, 163
CviJI	RGCY	3 cut(s)	13, 17, 84
CviKI_1	RGCY	3 cut(s)	13, 17, 84
FaeI	CATG	2 cut(s)	41, 166
FaiI	YATR	8 cut(s)	39, 52, 87, 127, 164, 173, 207, 216
FatI	CATG	2 cut(s)	37, 162
FokI	GGATG	2 cut(s)	17, 130
FspBI	CTAG	2 cut(s)	14, 18
Hin1II	CATG	2 cut(s)	41, 166
HinfI	GANTC	1 cut(s)	192
HpyAV	CCTTC	1 cut(s)	3
HpyCH4V	TGCA	3 cut(s)	50, 125, 171
Hsp92II	CATG	2 cut(s)	41, 166
LpnPI	CCDG	2 cut(s)	79, 116
MaeI	CTAG	2 cut(s)	14, 18
MaeIII	GTNAC	1 cut(s)	40
MboII	GAAGA	1 cut(s)	19
MluCI	AATT	1 cut(s)	166
MnlI	CCTC	1 cut(s)	15
MseI	TTAA	2 cut(s)	108, 198
NheI	GCTAGC	1 cut(s)	13
NlaIII	CATG	2 cut(s)	41, 166
NmuCI	GTSAC	1 cut(s)	40
NspI	RCATGY	1 cut(s)	41
PciI	ACATGT	1 cut(s)	37
PfeI	GAWTC	1 cut(s)	192
PscI	ACATGT	1 cut(s)	37
SaqAI	TTAA	2 cut(s)	108, 198
SetI	ASST	3 cut(s)	19, 26, 86
Sse9I	AATT	1 cut(s)	166
SspMI	CTAG	2 cut(s)	14, 18
TaqI	TCGA	1 cut(s)	77
TasI	AATT	1 cut(s)	166
TfiI	GAWTC	1 cut(s)	192
Tru1I	TTAA	2 cut(s)	108, 198
Tru9I	TTAA	2 cut(s)	108, 198
TseFI	GTSAC	1 cut(s)	40
Tsp45I	GTSAC	1 cut(s)	40
TspDTI	ATGAA	3 cut(s)	102, 179, 222
XceI	RCATGY	1 cut(s)	41
XspI	CTAG	2 cut(s)	14, 18

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.