Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr16

Orthogroup ID

OG0000513

Physical Location & Seq

Genomic Coordinates Reverse (-)

28919067 .. 28919985

Gene Structure 919 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom16g26410.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 336 bp

ATGGCTTCGTCACCTTCCAGGTGTCGGCCAGCACAACTCGATTCAGGGTCCAAGTGGACTTTCTGGGTCGGGGTAAATAAAGTACATATTCATGCTCGTGAGGCTTGTAGGAGTCCCACCATACCCATTTCAGTTCAAGCTTGTAGGAAGCTTGGTGAGGTCCCTAGGAGACTCGGGGTGGTTCGTTTGAAGGTTTTGGACGTCGGGATAGTGAGTTTCGAGGTTGGCCAGAATTGGGGTGATTTTCCAGTTGTTTCGCATATAGGTGAATCCTATCCCGAGGACGAGCGTGGTCACTCGAGGCAGGGGGGTTACGACCCTTCCACATACCAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

112

Amino Acids

12.32

Weight (kDa)

8.96

Isoelectric Point (pI)

63.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000513)

Species	Orthologous Gene IDs
malus_domestica	MD00G1165900.v1.1 MD01G1149400.v1.1 MD02G1188500.v1.1 MD06G1074500.v1.1 MD06G1183900.v1.1 MD08G1220300.v1.1 MD11G1317300.v1.1 MD12G1033900.v1.1 MD13G1075700.v1.1 MD13G1253200.v1.1 MD16G1023900.v1.1
pyrus_communis	pycom01g00140 pycom01g00540 pycom01g00600 pycom01g00660 pycom01g00920 pycom01g00970 pycom01g02740 pycom01g04610 pycom01g10660 pycom01g21320 pycom02g07390 pycom02g17600 pycom02g18670 pycom02g18770 pycom03g02770 pycom03g15990 pycom03g21130 pycom04g16620 pycom04g21450 pycom05g06020 pycom05g08170 pycom05g13560 pycom05g22750 pycom05g23690 pycom05g23730 pycom05g23760 pycom05g23950 pycom05g24030 pycom07g12530 pycom07g12550 pycom08g01040 pycom08g16160 pycom10g03920 pycom11g13260 pycom11g13940 pycom11g16660 pycom12556g00120 pycom12661g00080 pycom12g07880 pycom13g05260 pycom13g11350 pycom13g15930 pycom13g23350 pycom13g23690 pycom13g23750 pycom13g23880 pycom13g24500 pycom13g24620 pycom13g26020 pycom13g26300 pycom13g27320 pycom13g28360 pycom14g12840 pycom15g17240 pycom15g31400 pycom15g32660 pycom16g21180 pycom16g21190 pycom16g22580 pycom16g24640 pycom16g26060 pycom16g26400 pycom16g26410 pycom17g03930 pycom17g16310 pycom17g16320 pycom17g16920 pycom420g00790 pycom520g00370 pycom520g00530 pycom520g00830 pycom520g00840 pycom520g00880 pycom520g00930 pycom808g00600
rosa_chinensis	RchiOBHm_Chr2g0089701

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	204
AcoI	YGGCCR	2 cut(s)	26, 226
AcyI	GRCGYC	1 cut(s)	201
AfaI	GTAC	1 cut(s)	84
AfiI	CCNNNNNNNGG	2 cut(s)	24, 235
AgsI	TTSAA	2 cut(s)	137, 190
AjnI	CCWGG	1 cut(s)	17
AjuI	GAANNNNNNNTTGG	2 cut(s)	44, 76
AluBI	AGCT	2 cut(s)	140, 151
AluI	AGCT	2 cut(s)	140, 151
Alw26I	GTCTC	1 cut(s)	163
Ama87I	CYCGRG	3 cut(s)	173, 278, 298
AoxI	GGCC	2 cut(s)	26, 226
AspA2I	CCTAGG	1 cut(s)	164
AspS9I	GGNCC	2 cut(s)	48, 160
AsuHPI	GGTGA	4 cut(s)	3, 167, 251, 278
AvaI	CYCGRG	3 cut(s)	173, 278, 298
AvaII	GGWCC	2 cut(s)	48, 160
AvrII	CCTAGG	1 cut(s)	164
BalI	TGGCCA	1 cut(s)	228
BauI	CACGAG	1 cut(s)	96
BciT130I	CCWGG	1 cut(s)	19
BcoDI	GTCTC	1 cut(s)	163
BfaI	CTAG	1 cut(s)	165
BlnI	CCTAGG	1 cut(s)	164
Bme1390I	CCNGG	1 cut(s)	19
Bme18I	GGWCC	2 cut(s)	48, 160
BmeT110I	CYCGRG	3 cut(s)	173, 278, 298
BmgT120I	GGNCC	2 cut(s)	48, 160
BmiI	GGNNCC	2 cut(s)	49, 162
BmrFI	CCNGG	1 cut(s)	19
BsaHI	GRCGYC	1 cut(s)	201
BsaJI	CCNNGG	2 cut(s)	164, 279
Bsc4I	CCNNNNNNNGG	2 cut(s)	24, 235
Bse1I	ACTGG	2 cut(s)	248, 331
BseBI	CCWGG	1 cut(s)	19
BseDI	CCNNGG	2 cut(s)	164, 279
BseLI	CCNNNNNNNGG	2 cut(s)	24, 235
BseNI	ACTGG	2 cut(s)	248, 331
BshFI	GGCC	2 cut(s)	28, 228
BsiHKCI	CYCGRG	3 cut(s)	173, 278, 298
BslFI	GGGAC	2 cut(s)	99, 146
BslI	CCNNNNNNNGG	2 cut(s)	24, 235
BsmAI	GTCTC	1 cut(s)	163
BsmFI	GGGAC	2 cut(s)	99, 146
BsnI	GGCC	2 cut(s)	28, 228
BsoBI	CYCGRG	3 cut(s)	173, 278, 298
BspANI	GGCC	2 cut(s)	28, 228
BspLI	GGNNCC	2 cut(s)	49, 162
BsrI	ACTGG	2 cut(s)	248, 331
BssECI	CCNNGG	2 cut(s)	164, 279
BssNI	GRCGYC	1 cut(s)	201
BssSI	CACGAG	1 cut(s)	96
BssT1I	CCWWGG	1 cut(s)	164
Bst2BI	CACGAG	1 cut(s)	96
Bst2UI	CCWGG	1 cut(s)	19
BstACI	GRCGYC	1 cut(s)	201
BstC8I	GCNNGC	1 cut(s)	30
BstMAI	GTCTC	1 cut(s)	163
BstMWI	GCNNNNNNNGC	1 cut(s)	101
BstNI	CCWGG	1 cut(s)	19
BstSCI	CCNGG	1 cut(s)	17
BsuRI	GGCC	2 cut(s)	28, 228
Cac8I	GCNNGC	1 cut(s)	30
Cfr13I	GGNCC	2 cut(s)	48, 160
Csp6I	GTAC	1 cut(s)	83
CviAII	CATG	1 cut(s)	92
CviJI	RGCY	6 cut(s)	5, 28, 104, 140, 151, 228
CviKI_1	RGCY	6 cut(s)	5, 28, 104, 140, 151, 228
CviQI	GTAC	1 cut(s)	83
EaeI	YGGCCR	2 cut(s)	26, 226
Eco130I	CCWWGG	1 cut(s)	164
Eco47I	GGWCC	2 cut(s)	48, 160
Eco88I	CYCGRG	3 cut(s)	173, 278, 298
EcoO109I	RGGNCCY	1 cut(s)	160
EcoRII	CCWGG	1 cut(s)	17
EcoT14I	CCWWGG	1 cut(s)	164
ErhI	CCWWGG	1 cut(s)	164
FaeI	CATG	1 cut(s)	95
FaiI	YATR	6 cut(s)	87, 93, 122, 261, 263, 328
FaqI	GGGAC	2 cut(s)	99, 146
FatI	CATG	1 cut(s)	91
FspBI	CTAG	1 cut(s)	165
HaeIII	GGCC	2 cut(s)	28, 228
Hin1I	GRCGYC	1 cut(s)	201
Hin1II	CATG	1 cut(s)	95
HindIII	AAGCTT	2 cut(s)	138, 149
HinfI	GANTC	4 cut(s)	41, 112, 171, 269
HphI	GGTGA	4 cut(s)	3, 167, 251, 278
Hpy166II	GTNNAC	1 cut(s)	57
Hpy188III	TCNNGA	3 cut(s)	98, 205, 278
Hpy8I	GTNNAC	1 cut(s)	57
Hpy99I	CGWCG	1 cut(s)	206
HpyAV	CCTTC	3 cut(s)	24, 184, 330
HpyCH4IV	ACGT	1 cut(s)	201
HpyF10VI	GCNNNNNNNGC	1 cut(s)	101
HpySE526I	ACGT	1 cut(s)	201
Hsp92I	GRCGYC	1 cut(s)	201
Hsp92II	CATG	1 cut(s)	95
LpnPI	CCDG	8 cut(s)	4, 30, 31, 42, 49, 242, 261, 290
MaeI	CTAG	1 cut(s)	165
MaeII	ACGT	1 cut(s)	201
MaeIII	GTNAC	3 cut(s)	9, 293, 311
MlsI	TGGCCA	1 cut(s)	228
MluCI	AATT	1 cut(s)	232
MluNI	TGGCCA	1 cut(s)	228
MlyI	GAGTC	2 cut(s)	121, 165
MnlI	CCTC	5 cut(s)	94, 151, 214, 274, 294
Mox20I	TGGCCA	1 cut(s)	228
MscI	TGGCCA	1 cut(s)	228
MslI	CAYNNNNRTG	4 cut(s)	90, 96, 264, 331
Msp20I	TGGCCA	1 cut(s)	228
MspR9I	CCNGG	1 cut(s)	19
MvaI	CCWGG	1 cut(s)	19
MwoI	GCNNNNNNNGC	1 cut(s)	101
NlaIII	CATG	1 cut(s)	95
NlaIV	GGNNCC	2 cut(s)	49, 162
NmuCI	GTSAC	2 cut(s)	9, 293
PaeR7I	CTCGAG	1 cut(s)	298
PfeI	GAWTC	2 cut(s)	41, 269
PleI	GAGTC	2 cut(s)	120, 165
PpsI	GAGTC	2 cut(s)	120, 165
PpuMI	RGGWCCY	1 cut(s)	160
Psp5II	RGGWCCY	1 cut(s)	160
Psp6I	CCWGG	1 cut(s)	17
PspGI	CCWGG	1 cut(s)	17
PspN4I	GGNNCC	2 cut(s)	49, 162
PspPI	GGNCC	2 cut(s)	48, 160
PspPPI	RGGWCCY	1 cut(s)	160
PspXI	VCTCGAGB	1 cut(s)	298
RsaI	GTAC	1 cut(s)	84
RsaNI	GTAC	1 cut(s)	83
RseI	CAYNNNNRTG	4 cut(s)	90, 96, 264, 331
Sau96I	GGNCC	2 cut(s)	48, 160
SchI	GAGTC	2 cut(s)	121, 165
ScrFI	CCNGG	1 cut(s)	19
SetI	ASST	9 cut(s)	16, 23, 142, 153, 162, 195, 204, 225, 268
Sfr274I	CTCGAG	1 cut(s)	298
SinI	GGWCC	2 cut(s)	48, 160
SlaI	CTCGAG	1 cut(s)	298
SmiMI	CAYNNNNRTG	4 cut(s)	90, 96, 264, 331
SmlI	CTYRAG	1 cut(s)	298
SmoI	CTYRAG	1 cut(s)	298
Sse9I	AATT	1 cut(s)	232
SspMI	CTAG	1 cut(s)	165
StyD4I	CCNGG	1 cut(s)	17
StyI	CCWWGG	1 cut(s)	164
TaiI	ACGT	1 cut(s)	204
TaqI	TCGA	3 cut(s)	39, 219, 299
TasI	AATT	1 cut(s)	232
TatI	WGTACW	1 cut(s)	82
TfiI	GAWTC	2 cut(s)	41, 269
TseFI	GTSAC	2 cut(s)	9, 293
Tsp45I	GTSAC	2 cut(s)	9, 293
TspDTI	ATGAA	1 cut(s)	80
VpaK11BI	GGWCC	2 cut(s)	48, 160
XhoI	CTCGAG	1 cut(s)	298
XmaJI	CCTAGG	1 cut(s)	164
XspI	CTAG	1 cut(s)	165
ZraI	GACGTC	1 cut(s)	202

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.