RchiOBHm_Chr2g0089701

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0000513
Physical Location & Seq
Reverse (-)
3812404 .. 3814342
1939 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ46500

Sequence Viewer

Length: 165 bp
ATGGAACAAGGTAAACCATGCATACGGTATATCTCTTTGGTGAAGGCTTCCGCGATGATCGGAGCATTGTATGGGTGCGTCAGAGCAACAAAGTGCCCATATTTGGATAGCCGATCAACCACCACCATGATTGCATTCTTACCATCTGAAAGAGGGAGGCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

5.94

Weight (kDa)

9.57

Isoelectric Point (pI)

34.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 53
AciI CCGC 1 cut(s) 51
AfiI CCNNNNNNNGG 1 cut(s) 103
AoxI GGCC 1 cut(s) 158
AsuHPI GGTGA 1 cut(s) 52
BaeGI GKGCMC 1 cut(s) 98
BccI CCATC 1 cut(s) 151
Bsc4I CCNNNNNNNGG 1 cut(s) 103
BseLI CCNNNNNNNGG 1 cut(s) 103
BseSI GKGCMC 1 cut(s) 98
Bsh1236I CGCG 1 cut(s) 53
BshFI GGCC 1 cut(s) 160
BslI CCNNNNNNNGG 1 cut(s) 103
BsmI GAATGC 1 cut(s) 134
BsnI GGCC 1 cut(s) 160
Bsp1286I GDGCHC 1 cut(s) 98
Bsp143I GATC 2 cut(s) 57, 113
BspACI CCGC 1 cut(s) 51
BspANI GGCC 1 cut(s) 160
BspFNI CGCG 1 cut(s) 53
BssMI GATC 2 cut(s) 57, 113
Bst4CI ACNGT 1 cut(s) 27
BstFNI CGCG 1 cut(s) 53
BstKTI GATC 2 cut(s) 60, 116
BstMBI GATC 2 cut(s) 57, 113
BstSLI GKGCMC 1 cut(s) 98
BstUI CGCG 1 cut(s) 53
BsuRI GGCC 1 cut(s) 160
BtgZI GCGATG 1 cut(s) 68
CseI GACGC 1 cut(s) 67
CspCI CAANNNNNGTGG 2 cut(s) 112, 147
CviAII CATG 2 cut(s) 18, 127
CviJI RGCY 3 cut(s) 47, 111, 160
CviKI_1 RGCY 3 cut(s) 47, 111, 160
DpnI GATC 2 cut(s) 59, 115
DpnII GATC 2 cut(s) 57, 113
EcoT22I ATGCAT 1 cut(s) 23
FaeI CATG 2 cut(s) 21, 130
FaiI YATR 7 cut(s) 19, 23, 30, 72, 100, 128, 163
FatI CATG 2 cut(s) 17, 126
HaeIII GGCC 1 cut(s) 160
HgaI GACGC 1 cut(s) 67
Hin1II CATG 2 cut(s) 21, 130
HphI GGTGA 1 cut(s) 52
Hpy166II GTNNAC 1 cut(s) 14
Hpy188I TCNGA 3 cut(s) 62, 83, 148
Hpy8I GTNNAC 1 cut(s) 14
HpyAV CCTTC 1 cut(s) 37
HpyCH4III ACNGT 1 cut(s) 27
HpyCH4V TGCA 2 cut(s) 21, 134
Hsp92II CATG 2 cut(s) 21, 130
Kzo9I GATC 2 cut(s) 57, 113
LmnI GCTCC 1 cut(s) 62
MalI GATC 2 cut(s) 59, 115
MboI GATC 2 cut(s) 57, 113
MhlI GDGCHC 1 cut(s) 98
MnlI CCTC 2 cut(s) 146, 150
Mph1103I ATGCAT 1 cut(s) 23
MslI CAYNNNNRTG 1 cut(s) 125
Mva1269I GAATGC 1 cut(s) 134
MvnI CGCG 1 cut(s) 53
NdeII GATC 2 cut(s) 57, 113
NlaIII CATG 2 cut(s) 21, 130
NsiI ATGCAT 1 cut(s) 23
PctI GAATGC 1 cut(s) 134
RseI CAYNNNNRTG 1 cut(s) 125
Sau3AI GATC 2 cut(s) 57, 113
SduI GDGCHC 1 cut(s) 98
SetI ASST 1 cut(s) 13
SgeI CNNG 4 cut(s) 20, 30, 64, 139
SmiMI CAYNNNNRTG 1 cut(s) 125
SsiI CCGC 1 cut(s) 51
TaaI ACNGT 1 cut(s) 27
Zsp2I ATGCAT 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.