Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr8

Orthogroup ID

OG0000513

Physical Location & Seq

Genomic Coordinates Reverse (-)

811861 .. 812926

Gene Structure 1066 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom08g01040.4

Sequence Viewer

CDS Protein Promoter (2k)

Length: 381 bp

ATGTTGCCCCTAGTTCGTTTTTGGCACGTTGTGGGTTGTTTGTGTGGGGTGGCAGGTGTTGGACAACTCACACACACATTGCCACACTCTCCCTCTCCCTCTGCCTCTGTCCCGTGTCTCTCTCTCTCTCTTCCCTTCTTCTTCTTCTTCCTTCTACGTACGGACAAACATCAAAACCATACCATTTTCAGTTGTGTTGGTGAGGTCCCAAGGAGCCTCGGAGTGCTTCGTTGGACAAAATTGGACGTCGGGATCGTCCTGTTCGAAGTTGGCCGAGCTTGGAGTTTTTGCACAGTTGTTTCGCATTTAGGTGACACGTACCCAGAGGACGAGCGTGCACACGCGAGACAGGGGGGCTACGACCCTTCTACATACCAGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

127

Amino Acids

14.0

Weight (kDa)

7.04

Isoelectric Point (pI)

46.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000513)

Species	Orthologous Gene IDs
malus_domestica	MD00G1165900.v1.1 MD01G1149400.v1.1 MD02G1188500.v1.1 MD06G1074500.v1.1 MD06G1183900.v1.1 MD08G1220300.v1.1 MD11G1317300.v1.1 MD12G1033900.v1.1 MD13G1075700.v1.1 MD13G1253200.v1.1 MD16G1023900.v1.1
pyrus_communis	pycom01g00140 pycom01g00540 pycom01g00600 pycom01g00660 pycom01g00920 pycom01g00970 pycom01g02740 pycom01g04610 pycom01g10660 pycom01g21320 pycom02g07390 pycom02g17600 pycom02g18670 pycom02g18770 pycom03g02770 pycom03g15990 pycom03g21130 pycom04g16620 pycom04g21450 pycom05g06020 pycom05g08170 pycom05g13560 pycom05g22750 pycom05g23690 pycom05g23730 pycom05g23760 pycom05g23950 pycom05g24030 pycom07g12530 pycom07g12550 pycom08g01040 pycom08g16160 pycom10g03920 pycom11g13260 pycom11g13940 pycom11g16660 pycom12556g00120 pycom12661g00080 pycom12g07880 pycom13g05260 pycom13g11350 pycom13g15930 pycom13g23350 pycom13g23690 pycom13g23750 pycom13g23880 pycom13g24500 pycom13g24620 pycom13g26020 pycom13g26300 pycom13g27320 pycom13g28360 pycom14g12840 pycom15g17240 pycom15g31400 pycom15g32660 pycom16g21180 pycom16g21190 pycom16g22580 pycom16g24640 pycom16g26060 pycom16g26400 pycom16g26410 pycom17g03930 pycom17g16310 pycom17g16320 pycom17g16920 pycom420g00790 pycom520g00370 pycom520g00530 pycom520g00830 pycom520g00840 pycom520g00880 pycom520g00930 pycom808g00600
rosa_chinensis	RchiOBHm_Chr2g0089701

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	44
AatII	GACGTC	1 cut(s)	249
Acc36I	ACCTGC	1 cut(s)	44
AccII	CGCG	1 cut(s)	344
AclWI	GGATC	1 cut(s)	260
AcoI	YGGCCR	1 cut(s)	271
AcyI	GRCGYC	1 cut(s)	246
AdeI	CACNNNGTG	1 cut(s)	31
AfaI	GTAC	2 cut(s)	160, 320
AflIII	ACRYGT	1 cut(s)	315
AluBI	AGCT	1 cut(s)	278
AluI	AGCT	1 cut(s)	278
Alw21I	GWGCWC	1 cut(s)	340
Alw26I	GTCTC	2 cut(s)	122, 340
Alw44I	GTGCAC	1 cut(s)	336
AlwI	GGATC	1 cut(s)	260
AoxI	GGCC	1 cut(s)	271
ApaLI	GTGCAC	1 cut(s)	336
AspS9I	GGNCC	1 cut(s)	205
AsuHPI	GGTGA	2 cut(s)	212, 323
AsuII	TTCGAA	1 cut(s)	264
AvaII	GGWCC	1 cut(s)	205
BaeGI	GKGCMC	1 cut(s)	340
Bbv12I	GWGCWC	1 cut(s)	340
BcoDI	GTCTC	2 cut(s)	122, 340
BfaI	CTAG	1 cut(s)	11
BfuAI	ACCTGC	1 cut(s)	44
Bme18I	GGWCC	1 cut(s)	205
BmgT120I	GGNCC	1 cut(s)	205
BmiI	GGNNCC	2 cut(s)	207, 215
Bpu14I	TTCGAA	1 cut(s)	264
BsaAI	YACGTR	2 cut(s)	158, 318
BsaHI	GRCGYC	1 cut(s)	246
BsaJI	CCNNGG	2 cut(s)	209, 217
Bse1I	ACTGG	1 cut(s)	376
Bse3DI	GCAATG	1 cut(s)	77
BseDI	CCNNGG	2 cut(s)	209, 217
BseMI	GCAATG	1 cut(s)	77
BseNI	ACTGG	1 cut(s)	376
BseSI	GKGCMC	1 cut(s)	340
Bsh1236I	CGCG	1 cut(s)	344
BshFI	GGCC	1 cut(s)	273
BsiHKAI	GWGCWC	1 cut(s)	340
BsiWI	CGTACG	1 cut(s)	158
BslFI	GGGAC	2 cut(s)	95, 191
BsmAI	GTCTC	2 cut(s)	122, 340
BsmFI	GGGAC	2 cut(s)	95, 191
BsnI	GGCC	1 cut(s)	273
Bsp119I	TTCGAA	1 cut(s)	264
Bsp1286I	GDGCHC	1 cut(s)	340
Bsp143I	GATC	1 cut(s)	252
BspANI	GGCC	1 cut(s)	273
BspFNI	CGCG	1 cut(s)	344
BspLI	GGNNCC	2 cut(s)	207, 215
BspMI	ACCTGC	1 cut(s)	44
BspPI	GGATC	1 cut(s)	260
BspT104I	TTCGAA	1 cut(s)	264
BsrDI	GCAATG	1 cut(s)	77
BsrI	ACTGG	1 cut(s)	376
BssECI	CCNNGG	2 cut(s)	209, 217
BssMI	GATC	1 cut(s)	252
BssNI	GRCGYC	1 cut(s)	246
BssT1I	CCWWGG	1 cut(s)	209
Bst4CI	ACNGT	1 cut(s)	295
Bst6I	CTCTTC	1 cut(s)	135
BstACI	GRCGYC	1 cut(s)	246
BstBAI	YACGTR	2 cut(s)	158, 318
BstBI	TTCGAA	1 cut(s)	264
BstC8I	GCNNGC	1 cut(s)	336
BstFNI	CGCG	1 cut(s)	344
BstKTI	GATC	1 cut(s)	255
BstMAI	GTCTC	2 cut(s)	122, 340
BstMBI	GATC	1 cut(s)	252
BstSLI	GKGCMC	1 cut(s)	340
BstSNI	TACGTA	1 cut(s)	158
BstUI	CGCG	1 cut(s)	344
BsuRI	GGCC	1 cut(s)	273
BveI	ACCTGC	1 cut(s)	44
Cac8I	GCNNGC	1 cut(s)	336
Cfr13I	GGNCC	1 cut(s)	205
Csp6I	GTAC	2 cut(s)	159, 319
CviJI	RGCY	4 cut(s)	216, 273, 278, 357
CviKI_1	RGCY	4 cut(s)	216, 273, 278, 357
CviQI	GTAC	2 cut(s)	159, 319
DpnI	GATC	1 cut(s)	254
DpnII	GATC	1 cut(s)	252
DraIII	CACNNNGTG	1 cut(s)	31
EaeI	YGGCCR	1 cut(s)	271
Eam1104I	CTCTTC	1 cut(s)	135
EarI	CTCTTC	1 cut(s)	135
Eco105I	TACGTA	1 cut(s)	158
Eco130I	CCWWGG	1 cut(s)	209
Eco47I	GGWCC	1 cut(s)	205
EcoO109I	RGGNCCY	1 cut(s)	205
EcoT14I	CCWWGG	1 cut(s)	209
ErhI	CCWWGG	1 cut(s)	209
FaiI	YATR	2 cut(s)	180, 373
FaqI	GGGAC	2 cut(s)	95, 191
FspBI	CTAG	1 cut(s)	11
HaeIII	GGCC	1 cut(s)	273
Hin1I	GRCGYC	1 cut(s)	246
HphI	GGTGA	2 cut(s)	212, 323
Hpy166II	GTNNAC	1 cut(s)	338
Hpy188I	TCNGA	1 cut(s)	221
Hpy188III	TCNNGA	1 cut(s)	250
Hpy8I	GTNNAC	1 cut(s)	338
Hpy99I	CGWCG	1 cut(s)	251
HpyAV	CCTTC	3 cut(s)	145, 161, 375
HpyCH4III	ACNGT	1 cut(s)	295
HpyCH4IV	ACGT	4 cut(s)	27, 157, 246, 317
HpyCH4V	TGCA	2 cut(s)	291, 338
HpySE526I	ACGT	4 cut(s)	27, 157, 246, 317
Hsp92I	GRCGYC	1 cut(s)	246
Kzo9I	GATC	1 cut(s)	252
LmnI	GCTCC	1 cut(s)	213
LpnPI	CCDG	4 cut(s)	39, 272, 335, 336
MaeI	CTAG	1 cut(s)	11
MaeII	ACGT	4 cut(s)	27, 157, 246, 317
MaeIII	GTNAC	1 cut(s)	311
MalI	GATC	1 cut(s)	254
MboI	GATC	1 cut(s)	252
MboII	GAAGA	5 cut(s)	122, 130, 133, 136, 139
MhlI	GDGCHC	1 cut(s)	340
MluCI	AATT	1 cut(s)	239
MmeI	TCCRAC	2 cut(s)	40, 212
MnlI	CCTC	6 cut(s)	103, 109, 115, 196, 227, 319
MslI	CAYNNNNRTG	1 cut(s)	309
MvnI	CGCG	1 cut(s)	344
NdeII	GATC	1 cut(s)	252
NlaIV	GGNNCC	2 cut(s)	207, 215
NmeAIII	GCCGAG	1 cut(s)	299
NmuCI	GTSAC	1 cut(s)	311
NspV	TTCGAA	1 cut(s)	264
PaqCI	CACCTGC	1 cut(s)	44
PcsI	WCGNNNNNNNCGW	2 cut(s)	252, 261
Pfl23II	CGTACG	1 cut(s)	158
Ppu21I	YACGTR	2 cut(s)	158, 318
PpuMI	RGGWCCY	1 cut(s)	205
Psp5II	RGGWCCY	1 cut(s)	205
PspLI	CGTACG	1 cut(s)	158
PspN4I	GGNNCC	2 cut(s)	207, 215
PspPI	GGNCC	1 cut(s)	205
PspPPI	RGGWCCY	1 cut(s)	205
RsaI	GTAC	2 cut(s)	160, 320
RsaNI	GTAC	2 cut(s)	159, 319
RseI	CAYNNNNRTG	1 cut(s)	309
Sau3AI	GATC	1 cut(s)	252
Sau96I	GGNCC	1 cut(s)	205
SduI	GDGCHC	1 cut(s)	340
SetI	ASST	8 cut(s)	30, 58, 160, 207, 249, 280, 313, 320
SfuI	TTCGAA	1 cut(s)	264
SinI	GGWCC	1 cut(s)	205
SmiMI	CAYNNNNRTG	1 cut(s)	309
SnaBI	TACGTA	1 cut(s)	158
Sse9I	AATT	1 cut(s)	239
SspMI	CTAG	1 cut(s)	11
StyI	CCWWGG	1 cut(s)	209
TaaI	ACNGT	1 cut(s)	295
TaiI	ACGT	4 cut(s)	30, 160, 249, 320
TaqI	TCGA	1 cut(s)	264
TasI	AATT	1 cut(s)	239
TseFI	GTSAC	1 cut(s)	311
Tsp45I	GTSAC	1 cut(s)	311
TspGWI	ACGGA	1 cut(s)	176
VneI	GTGCAC	1 cut(s)	336
VpaK11BI	GGWCC	1 cut(s)	205
XspI	CTAG	1 cut(s)	11
ZraI	GACGTC	1 cut(s)	247

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.