MD16G1023900.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
OG0000513
Physical Location & Seq
Reverse (-)
1726194 .. 1726742
549 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1023900.v1.1.491

Sequence Viewer

Length: 261 bp
ATGACGGAATTACCCTTGACGGGTATTAAGGAAAATAAGGGTGGAATTGTTTTGAGGGACCACACACACACACGGGACACCCTGTCCCTTTCCCCGTGCCCTCTATCTCTCTCCCCTTCTCAGTTCTTCCTCTCTCCCTCTCGACTCGTACGGACGAGGCACCAAAACCCTCCAACTTTCACGGATCGACGTCAAAAAGGGAATTCTAAGCTTATAGTGAGCTTAGTGAGGTCCCAAGGAAGCTCGGAGTGTTTCGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.6

Weight (kDa)

10.41

Isoelectric Point (pI)

62.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 193
AccB1I GGYRCC 1 cut(s) 159
AclWI GGATC 1 cut(s) 192
AcsI RAATTY 1 cut(s) 202
AcyI GRCGYC 1 cut(s) 190
AfaI GTAC 1 cut(s) 150
AfiI CCNNNNNNNGG 1 cut(s) 20
AhdI GACNNNNNGTC 1 cut(s) 82
AluBI AGCT 3 cut(s) 211, 222, 243
AluI AGCT 3 cut(s) 211, 222, 243
AlwI GGATC 1 cut(s) 192
ApoI RAATTY 1 cut(s) 202
AspS9I GGNCC 2 cut(s) 58, 231
AvaII GGWCC 2 cut(s) 58, 231
BaeGI GKGCMC 1 cut(s) 101
BanI GGYRCC 1 cut(s) 159
Bme18I GGWCC 2 cut(s) 58, 231
BmeRI GACNNNNNGTC 1 cut(s) 82
BmgT120I GGNCC 2 cut(s) 58, 231
BmiI GGNNCC 3 cut(s) 59, 161, 233
BsaHI GRCGYC 1 cut(s) 190
BsaJI CCNNGG 1 cut(s) 235
Bsc4I CCNNNNNNNGG 1 cut(s) 20
BseDI CCNNGG 1 cut(s) 235
BseLI CCNNNNNNNGG 1 cut(s) 20
BseMII CTCAG 1 cut(s) 134
BseSI GKGCMC 1 cut(s) 101
BshNI GGYRCC 1 cut(s) 159
BsiWI CGTACG 1 cut(s) 148
BslFI GGGAC 4 cut(s) 70, 71, 89, 217
BslI CCNNNNNNNGG 1 cut(s) 20
BsmFI GGGAC 4 cut(s) 70, 71, 89, 217
Bsp1286I GDGCHC 1 cut(s) 101
Bsp143I GATC 1 cut(s) 184
BspCNI CTCAG 1 cut(s) 133
BspLI GGNNCC 3 cut(s) 59, 161, 233
BspPI GGATC 1 cut(s) 192
BspT107I GGYRCC 1 cut(s) 159
BssECI CCNNGG 1 cut(s) 235
BssMI GATC 1 cut(s) 184
BssNI GRCGYC 1 cut(s) 190
BssT1I CCWWGG 1 cut(s) 235
BstACI GRCGYC 1 cut(s) 190
BstDEI CTNAG 3 cut(s) 120, 207, 223
BstKTI GATC 1 cut(s) 187
BstMBI GATC 1 cut(s) 184
BstSLI GKGCMC 1 cut(s) 101
Cfr13I GGNCC 2 cut(s) 58, 231
Csp6I GTAC 1 cut(s) 149
CviJI RGCY 3 cut(s) 211, 222, 243
CviKI_1 RGCY 3 cut(s) 211, 222, 243
CviQI GTAC 1 cut(s) 149
DdeI CTNAG 3 cut(s) 120, 207, 223
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
DriI GACNNNNNGTC 1 cut(s) 82
Eam1105I GACNNNNNGTC 1 cut(s) 82
Eco130I CCWWGG 1 cut(s) 235
Eco47I GGWCC 2 cut(s) 58, 231
EcoO109I RGGNCCY 1 cut(s) 231
EcoRI GAATTC 1 cut(s) 202
EcoT14I CCWWGG 1 cut(s) 235
ErhI CCWWGG 1 cut(s) 235
FaiI YATR 1 cut(s) 215
FaqI GGGAC 4 cut(s) 70, 71, 89, 217
Hin1I GRCGYC 1 cut(s) 190
HindIII AAGCTT 1 cut(s) 209
HinfI GANTC 1 cut(s) 144
Hpy188I TCNGA 1 cut(s) 247
Hpy188III TCNNGA 1 cut(s) 141
Hpy99I CGWCG 1 cut(s) 192
HpyAV CCTTC 1 cut(s) 126
HpyCH4IV ACGT 1 cut(s) 190
HpyF3I CTNAG 3 cut(s) 120, 207, 223
HpySE526I ACGT 1 cut(s) 190
Hsp92I GRCGYC 1 cut(s) 190
Kzo9I GATC 1 cut(s) 184
LpnPI CCDG 1 cut(s) 95
MaeII ACGT 1 cut(s) 190
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MboII GAAGA 1 cut(s) 118
MhlI GDGCHC 1 cut(s) 101
MluCI AATT 3 cut(s) 8, 45, 202
MlyI GAGTC 1 cut(s) 138
MmeI TCCRAC 1 cut(s) 197
MnlI CCTC 7 cut(s) 48, 111, 140, 148, 150, 180, 222
MseI TTAA 1 cut(s) 27
NdeII GATC 1 cut(s) 184
NlaIV GGNNCC 3 cut(s) 59, 161, 233
Pfl23II CGTACG 1 cut(s) 148
PleI GAGTC 1 cut(s) 138
PpsI GAGTC 1 cut(s) 138
PpuMI RGGWCCY 1 cut(s) 231
Psp5II RGGWCCY 1 cut(s) 231
PspLI CGTACG 1 cut(s) 148
PspN4I GGNNCC 3 cut(s) 59, 161, 233
PspPI GGNCC 2 cut(s) 58, 231
PspPPI RGGWCCY 1 cut(s) 231
RsaI GTAC 1 cut(s) 150
RsaNI GTAC 1 cut(s) 149
SaqAI TTAA 1 cut(s) 27
Sau3AI GATC 1 cut(s) 184
Sau96I GGNCC 2 cut(s) 58, 231
SchI GAGTC 1 cut(s) 138
SduI GDGCHC 1 cut(s) 101
SetI ASST 5 cut(s) 193, 213, 224, 233, 245
SinI GGWCC 2 cut(s) 58, 231
Sse9I AATT 3 cut(s) 8, 45, 202
StyI CCWWGG 1 cut(s) 235
TaiI ACGT 1 cut(s) 193
TaqI TCGA 2 cut(s) 142, 187
TasI AATT 3 cut(s) 8, 45, 202
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TspGWI ACGGA 3 cut(s) 20, 166, 197
VpaK11BI GGWCC 2 cut(s) 58, 231
XapI RAATTY 1 cut(s) 202
ZraI GACGTC 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.