Rmu_sc0004311.1_g000002

f-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004311.1
OG0000399
Physical Location & Seq
Reverse (-)
6230 .. 7396
1167 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004311.1_g000002.1.cds

Sequence Viewer

Length: 1167 bp
atgagagcaccgattagtaattatcgaagaaagaagaacgtcgtcactactgcagctcataagaactggtcaaaccttcatgatcatcaagatcttattaactgttttgcagagcaaatagtttccatgaaggatttctatgcttttggaggagtttgcagatcatggagatcagcagcgatcaaggaaaactctaatacaggtctgagattacagcataaagttccagtcctccttcttccaaaggagatcaatgctcccatctgcaatttttacagcttgacaaaaggtcagatttaccaacttgatttaccagaaactatgggcaagttttgctattcttctttaggatggttgttgactgtatccgaagatttttccaaacttcatctttttaatccattaacccatgtccaaattgagatgcctcgtctgcggccagaaatcatgacacttagaaatataaacaagtttgtattatcatcgagtccttcttggacatcgaattatggggtcatgattgtatcatatcatgaattggccttttaccagccagggtataacaatgacaaatggacttctgtatctttagggcaattatttactttaacggatgcaatttattataagggccaattttatgtcgtggactatcttggtaaggtttttgtctgtgagatagaagatcctaaaaatgcacagattagggctgttgctgcagggattccaaaggaactgctgttcggtcctgagattcattttaaagcaccatgtttagtggaatctgcaacagggaccttgttattggttatctctttatttgagcaaggcaaaactgaatcaactgttggttgtagggtattcaaggtgccatttgatgatggcaattcatgggcaaaatcagaagtaaagaatttggggaatagaaccttatttttgggtgcaaacaattcttcattctcgattgaggctttagatgattctatatggaaagccaattgtatttatttcttaaatcggagtcatgtctccgatgaagggcacatcgacattggcatttactatatgaaggatggaaaaatagagcgacactttgaagcatttccagattttcagtacaaaggcagatcaataacatcgcattcatggcttcaaccgagtttctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF295 F-box

Protein Analysis

388

Amino Acids

44.21

Weight (kDa)

8.29

Isoelectric Point (pI)

44.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000399)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g21230 FvH4_2g22763 FvH4_2g23250 FvH4_3g19214 FvH4_5g01761 FvH4_5g02180 FvH4_5g23981 FvH4_7g21350 FvH4_7g21590
malus_domestica MD00G1040400.v1.1 MD00G1057500.v1.1 MD05G1079000.v1.1 MD05G1357500.v1.1 MD05G1357800.v1.1
prunus_persica Prupe.4G213300_v2.0.a1 Prupe.8G190800_v2.0.a1 Prupe.8G190900_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0372911 RchiOBHm_Chr5g0006331 RchiOBHm_Chr5g0032291 RchiOBHm_Chr6g0287741 RchiOBHm_Chr6g0287791 RchiOBHm_Chr6g0289281 RchiOBHm_Chr6g0290581 RchiOBHm_Chr6g0290601 RchiOBHm_Chr7g0210061
rosa_laevigata RLG00000003898 RLG00000004101 RLG00000012190 RLG00000012194 RLG00000012196 RLG00000012198 RLG00000012199 RLG00000012200 RLG00000012278 RLG00000012316 RLG00000012346 RLG00000012468 RLG00000027389 RLG00000033378
rosa_multiflora Rmu_sc0000366.1_g000019 Rmu_sc0001082.1_g000011 Rmu_sc0001105.1_g000009 Rmu_sc0002290.1_g000001 Rmu_sc0003335.1_g000005 Rmu_sc0003335.1_g000007 Rmu_sc0003877.1_g000009 Rmu_sc0003877.1_g000011 Rmu_sc0004311.1_g000002 Rmu_sc0006266.1_g000019 Rmu_sc0006802.1_g000001 Rmu_sc0008789.1_g000004 Rmu_sc0010418.1_g000008 Rmu_sc0016104.1_g000004 Rmu_sc0022792.1_g000002 Rmu_sc0030012.1_g000001
rosa_roxburghii Rroxscaffold_3G00248640 Rroxscaffold_3G00258060 Rroxscaffold_4G00284630 Rroxscaffold_4G00291560 Rroxscaffold_7G00172250 Rroxscaffold_7G00176870 Rroxscaffold_7G00176900 Rroxscaffold_7G00176910 Rroxscaffold_7G00179370 Rroxscaffold_7G00181120 Rroxscaffold_7G00181140 Rroxscaffold_7G00181220
rosa_rugosa Rorug01G0324600 Rorug01G0324900 Rorug05G0130400 Rorug06G0191400 Rorug06G0191700 Rorug06G0192000 Rorug06G0192100 Rorug06G0199500 Rorug06G0199600 Rorug06G0210400 Rorug06G0213400 Rorug07G0044900
rosa_samantha Rh1BG289300 Rh5CG250500 Rh6DG111000 Rh6DG299100 Rh6DG299400 Rh6DG299700 Rh6DG300000 Rh6DG324600 Rh7BG171300
rosa_wichuraiana Rw0G015350 Rw1G029080 Rw1G029600 Rw5G020460 Rw6G026040 Rw6G028110 Rw6G028120 Rw6G028150 Rw6G031990 Rw7G014690 Rw7G014700 Rw7G015310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 627
AccB1I GGYRCC 1 cut(s) 868
AciI CCGC 1 cut(s) 436
AclWI GGATC 1 cut(s) 680
AcoI YGGCCR 1 cut(s) 437
AcsI RAATTY 1 cut(s) 913
AfaI GTAC 1 cut(s) 1118
AfiI CCNNNNNNNGG 1 cut(s) 1038
AgsI TTSAA 3 cut(s) 865, 1097, 1154
AhdI GACNNNNNGTC 1 cut(s) 288
AjnI CCWGG 1 cut(s) 553
AjuI GAANNNNNNNTTGG 2 cut(s) 831, 863
AloI GAACNNNNNNTCC 2 cut(s) 725, 757
AluBI AGCT 2 cut(s) 56, 279
AluI AGCT 2 cut(s) 56, 279
Alw21I GWGCWC 1 cut(s) 10
Alw26I GTCTC 1 cut(s) 1033
AlwI GGATC 1 cut(s) 680
AoxI GGCC 3 cut(s) 437, 540, 631
ApeKI GCWGC 3 cut(s) 53, 176, 716
ApoI RAATTY 1 cut(s) 913
Asp700I GAANNNNTTC 2 cut(s) 134, 1101
AspS9I GGNCC 3 cut(s) 631, 746, 795
AvaII GGWCC 2 cut(s) 746, 795
BaeGI GKGCMC 1 cut(s) 1044
BaeI ACNNNNGTAYC 2 cut(s) 567, 600
BanI GGYRCC 1 cut(s) 868
Bbv12I GWGCWC 1 cut(s) 10
BbvI GCAGC 3 cut(s) 65, 188, 703
BccI CCATC 4 cut(s) 269, 345, 875, 1067
BciT130I CCWGG 1 cut(s) 555
BciVI GTATCC 1 cut(s) 376
BclI TGATCA 1 cut(s) 82
BcoDI GTCTC 1 cut(s) 1033
BfmI CTRYAG 2 cut(s) 51, 717
BfuI GTATCC 1 cut(s) 376
BglII AGATCT 1 cut(s) 91
BisI GCNGC 4 cut(s) 54, 177, 437, 717
BlsI GCNGC 4 cut(s) 55, 178, 438, 718
Bme1390I CCNGG 1 cut(s) 555
Bme18I GGWCC 2 cut(s) 746, 795
BmeRI GACNNNNNGTC 1 cut(s) 288
BmgT120I GGNCC 3 cut(s) 631, 746, 795
BmiI GGNNCC 2 cut(s) 796, 870
BmrFI CCNGG 1 cut(s) 555
BmsI GCATC 2 cut(s) 414, 604
BsaJI CCNNGG 1 cut(s) 554
Bsc4I CCNNNNNNNGG 1 cut(s) 1038
Bse1I ACTGG 2 cut(s) 71, 227
BseBI CCWGG 1 cut(s) 555
BseDI CCNNGG 1 cut(s) 554
BseGI GGATG 3 cut(s) 356, 619, 1078
BseLI CCNNNNNNNGG 1 cut(s) 1038
BseMII CTCAG 2 cut(s) 197, 741
BseNI ACTGG 2 cut(s) 71, 227
BseRI GAGGAG 1 cut(s) 165
BseSI GKGCMC 1 cut(s) 1044
BseXI GCAGC 3 cut(s) 65, 188, 703
BshFI GGCC 3 cut(s) 439, 542, 633
BshNI GGYRCC 1 cut(s) 868
BsiHKAI GWGCWC 1 cut(s) 10
BslFI GGGAC 1 cut(s) 808
BslI CCNNNNNNNGG 1 cut(s) 1038
BsmAI GTCTC 1 cut(s) 1033
BsmFI GGGAC 1 cut(s) 808
BsmI GAATGC 1 cut(s) 1141
BsnI GGCC 3 cut(s) 439, 542, 633
Bsp1286I GDGCHC 2 cut(s) 10, 1044
Bsp143I GATC 8 cut(s) 82, 91, 161, 170, 180, 249, 685, 1127
BspACI CCGC 1 cut(s) 436
BspANI GGCC 3 cut(s) 439, 542, 633
BspCNI CTCAG 2 cut(s) 198, 742
BspHI TCATGA 4 cut(s) 79, 447, 516, 532
BspLI GGNNCC 2 cut(s) 796, 870
BspMAI CTGCAG 2 cut(s) 55, 721
BspPI GGATC 1 cut(s) 680
BspT107I GGYRCC 1 cut(s) 868
BsrI ACTGG 2 cut(s) 71, 227
BssECI CCNNGG 1 cut(s) 554
BssMI GATC 8 cut(s) 82, 91, 161, 170, 180, 249, 685, 1127
Bst2UI CCWGG 1 cut(s) 555
Bst4CI ACNGT 3 cut(s) 104, 364, 847
BstAPI GCANNNNNTGC 1 cut(s) 333
BstDEI CTNAG 3 cut(s) 206, 455, 750
BstF5I GGATG 3 cut(s) 356, 619, 1078
BstKTI GATC 8 cut(s) 85, 94, 164, 173, 183, 252, 688, 1130
BstMAI GTCTC 1 cut(s) 1033
BstMBI GATC 8 cut(s) 82, 91, 161, 170, 180, 249, 685, 1127
BstMWI GCNNNNNNNGC 4 cut(s) 333, 433, 716, 1147
BstNI CCWGG 1 cut(s) 555
BstSCI CCNGG 1 cut(s) 553
BstSFI CTRYAG 2 cut(s) 51, 717
BstSLI GKGCMC 1 cut(s) 1044
BstV1I GCAGC 3 cut(s) 65, 188, 703
BstX2I RGATCY 2 cut(s) 91, 685
BstYI RGATCY 2 cut(s) 91, 685
BsuI GTATCC 1 cut(s) 376
BsuRI GGCC 3 cut(s) 439, 542, 633
BtgZI GCGATG 1 cut(s) 1122
BtsCI GGATG 3 cut(s) 356, 619, 1078
CciI TCATGA 4 cut(s) 79, 447, 516, 532
Cfr13I GGNCC 3 cut(s) 631, 746, 795
Csp6I GTAC 1 cut(s) 1117
CviQI GTAC 1 cut(s) 1117
DdeI CTNAG 3 cut(s) 206, 455, 750
DpnI GATC 8 cut(s) 84, 93, 163, 172, 182, 251, 687, 1129
DpnII GATC 8 cut(s) 82, 91, 161, 170, 180, 249, 685, 1127
DraI TTTAAA 1 cut(s) 763
DriI GACNNNNNGTC 1 cut(s) 288
EaeI YGGCCR 1 cut(s) 437
Eam1105I GACNNNNNGTC 1 cut(s) 288
Eco47I GGWCC 2 cut(s) 746, 795
EcoO109I RGGNCCY 1 cut(s) 795
EcoRII CCWGG 1 cut(s) 553
FaqI GGGAC 1 cut(s) 808
FbaI TGATCA 1 cut(s) 82
Fnu4HI GCNGC 4 cut(s) 54, 177, 437, 717
FokI GGATG 3 cut(s) 363, 626, 1085
Fsp4HI GCNGC 4 cut(s) 54, 177, 437, 717
GluI GCNGC 4 cut(s) 54, 177, 437, 717
HaeIII GGCC 3 cut(s) 439, 542, 633
HincII GTYRAC 1 cut(s) 360
HindII GTYRAC 1 cut(s) 360
HinfI GANTC 7 cut(s) 487, 724, 754, 782, 839, 980, 1021
Hpy166II GTNNAC 2 cut(s) 360, 649
Hpy188I TCNGA 6 cut(s) 207, 294, 370, 904, 1020, 1033
Hpy188III TCNNGA 8 cut(s) 80, 89, 448, 517, 533, 749, 961, 1106
Hpy8I GTNNAC 2 cut(s) 360, 649
Hpy99I CGWCG 1 cut(s) 44
HpyAV CCTTC 6 cut(s) 86, 124, 245, 501, 1031, 1063
HpyCH4III ACNGT 3 cut(s) 104, 364, 847
HpyCH4IV ACGT 1 cut(s) 39
HpyCH4V TGCA 9 cut(s) 53, 110, 159, 267, 617, 698, 719, 788, 944
HpyF10VI GCNNNNNNNGC 4 cut(s) 333, 433, 716, 1147
HpyF3I CTNAG 3 cut(s) 206, 455, 750
HpySE526I ACGT 1 cut(s) 39
Ksp22I TGATCA 1 cut(s) 82
Kzo9I GATC 8 cut(s) 82, 91, 161, 170, 180, 249, 685, 1127
LmnI GCTCC 1 cut(s) 262
Lsp1109I GCAGC 3 cut(s) 65, 188, 703
LweI GCATC 2 cut(s) 414, 604
MaeII ACGT 1 cut(s) 39
MaeIII GTNAC 1 cut(s) 43
MalI GATC 8 cut(s) 84, 93, 163, 172, 182, 251, 687, 1129
MboI GATC 8 cut(s) 82, 91, 161, 170, 180, 249, 685, 1127
MboII GAAGA 7 cut(s) 39, 46, 230, 333, 383, 695, 945
MfeI CAATTG 1 cut(s) 997
MflI RGATCY 2 cut(s) 91, 685
MhlI GDGCHC 2 cut(s) 10, 1044
MlyI GAGTC 2 cut(s) 496, 1030
MnlI CCTC 4 cut(s) 143, 242, 438, 961
MroXI GAANNNNTTC 2 cut(s) 134, 1101
MseI TTAA 6 cut(s) 99, 396, 404, 608, 762, 1013
MspR9I CCNGG 1 cut(s) 555
MunI CAATTG 1 cut(s) 997
Mva1269I GAATGC 1 cut(s) 1141
MvaI CCWGG 1 cut(s) 555
MwoI GCNNNNNNNGC 4 cut(s) 333, 433, 716, 1147
NdeII GATC 8 cut(s) 82, 91, 161, 170, 180, 249, 685, 1127
NlaIV GGNNCC 2 cut(s) 796, 870
NmuCI GTSAC 1 cut(s) 43
PagI TCATGA 4 cut(s) 79, 447, 516, 532
PctI GAATGC 1 cut(s) 1141
PdmI GAANNNNTTC 2 cut(s) 134, 1101
PfeI GAWTC 5 cut(s) 724, 754, 782, 839, 980
PkrI GCNGC 4 cut(s) 55, 178, 438, 718
PleI GAGTC 2 cut(s) 495, 1029
PpsI GAGTC 2 cut(s) 495, 1029
PpuMI RGGWCCY 1 cut(s) 795
PsiI TTATAA 1 cut(s) 627
Psp5II RGGWCCY 1 cut(s) 795
Psp6I CCWGG 1 cut(s) 553
PspGI CCWGG 1 cut(s) 553
PspN4I GGNNCC 2 cut(s) 796, 870
PspPI GGNCC 3 cut(s) 631, 746, 795
PspPPI RGGWCCY 1 cut(s) 795
PstI CTGCAG 2 cut(s) 55, 721
PsuI RGATCY 2 cut(s) 91, 685
RsaI GTAC 1 cut(s) 1118
RsaNI GTAC 1 cut(s) 1117
SaqAI TTAA 6 cut(s) 99, 396, 404, 608, 762, 1013
SatI GCNGC 4 cut(s) 54, 177, 437, 717
Sau3AI GATC 8 cut(s) 82, 91, 161, 170, 180, 249, 685, 1127
Sau96I GGNCC 3 cut(s) 631, 746, 795
SchI GAGTC 2 cut(s) 496, 1030
ScrFI CCNGG 1 cut(s) 555
SduI GDGCHC 2 cut(s) 10, 1044
SfaNI GCATC 2 cut(s) 414, 604
SfcI CTRYAG 2 cut(s) 51, 717
SinI GGWCC 2 cut(s) 746, 795
SsiI CCGC 1 cut(s) 436
StyD4I CCNGG 1 cut(s) 553
TaaI ACNGT 3 cut(s) 104, 364, 847
TaiI ACGT 1 cut(s) 42
TaqI TCGA 5 cut(s) 25, 485, 503, 962, 1047
TaqII GACCGA 1 cut(s) 734
TatI WGTACW 1 cut(s) 1116
TauI GCSGC 1 cut(s) 439
TfiI GAWTC 5 cut(s) 724, 754, 782, 839, 980
Tru1I TTAA 6 cut(s) 99, 396, 404, 608, 762, 1013
Tru9I TTAA 6 cut(s) 99, 396, 404, 608, 762, 1013
TseFI GTSAC 1 cut(s) 43
TseI GCWGC 3 cut(s) 53, 176, 716
Tsp45I GTSAC 1 cut(s) 43
TspGWI ACGGA 1 cut(s) 626
VpaK11BI GGWCC 2 cut(s) 746, 795
XapI RAATTY 1 cut(s) 913
XmnI GAANNNNTTC 2 cut(s) 134, 1101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.