Rmu_sc0030012.1_g000001

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0030012.1
Physical Location & Seq
Forward (+)
75 .. 1106
1032 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0030012.1_g000001.1.cds

Sequence Viewer

Length: 1032 bp
atggccgatacgtcgaaacttcttccagatgagttggttgaccccgcagccacagtttctcgtgaagcaactcgagttccattgcttatgatacccaggaagaaggatacaaccgtcactgagttttacgacttggagatggacacgctttactcatcgaaactgcctgaacttaagggcaaattattttgttattcttcttctggaggatggctggtgactctatcagagtacaacgagcttgatctgctcaatcctttgaatcatcatgaccaatatgagctgccagattctaagagcgtgagtaattccatcccaaagaagtttgttttatcatccagcccttctccgacatcggattgcatagtgatggctctttatgagtgcggcaaattggaattctgtagtctaggaaaggatatagtatggacaagtatagtttcattcgggagaacagtaccatttttcgatctaactttttgtaagggagaattttatgttttgggccctaaaaatgtttgtgtttgtgactttgaagatcctaagcaagcacgtacgagaattgttggtccagaaatcccaggagaacttaggagtcttgaaggaaagagatatttggtggaatcagcaggctctttactaatggtcttgtatattgagcagcttggaatcaacaacatcgacgttcaaggaggatacaactccatctctgcatttagggtctttgaggtgccattcagtaacaatagttgttggttcgactccgagataaaggatttggggaatagaaccatcttcttgggtgaaaatcattccttctccgtcgatgcctcaaataacttcggagtcaagtacaattgtatttactttgcatacgattcgccatgtaaagaagaaatgatcgagatgggtatttttaacatgaaagacggaaagatcgagcgacccttcaaagttgtttcgagtggaagcaatacacatgagactcttataccacaccatttgtggattcaacaaggtcttttagtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

343

Amino Acids

38.56

Weight (kDa)

5.0

Isoelectric Point (pI)

38.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000399)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g21230 FvH4_2g22763 FvH4_2g23250 FvH4_3g19214 FvH4_5g01761 FvH4_5g02180 FvH4_5g23981 FvH4_7g21350 FvH4_7g21590
malus_domestica MD00G1040400.v1.1 MD00G1057500.v1.1 MD05G1079000.v1.1 MD05G1357500.v1.1 MD05G1357800.v1.1
prunus_persica Prupe.4G213300_v2.0.a1 Prupe.8G190800_v2.0.a1 Prupe.8G190900_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0372911 RchiOBHm_Chr5g0006331 RchiOBHm_Chr5g0032291 RchiOBHm_Chr6g0287741 RchiOBHm_Chr6g0287791 RchiOBHm_Chr6g0289281 RchiOBHm_Chr6g0290581 RchiOBHm_Chr6g0290601 RchiOBHm_Chr7g0210061
rosa_laevigata RLG00000003898 RLG00000004101 RLG00000012190 RLG00000012194 RLG00000012196 RLG00000012198 RLG00000012199 RLG00000012200 RLG00000012278 RLG00000012316 RLG00000012346 RLG00000012468 RLG00000027389 RLG00000033378
rosa_multiflora Rmu_sc0000366.1_g000019 Rmu_sc0001082.1_g000011 Rmu_sc0001105.1_g000009 Rmu_sc0002290.1_g000001 Rmu_sc0003335.1_g000005 Rmu_sc0003335.1_g000007 Rmu_sc0003877.1_g000009 Rmu_sc0003877.1_g000011 Rmu_sc0004311.1_g000002 Rmu_sc0006266.1_g000019 Rmu_sc0006802.1_g000001 Rmu_sc0008789.1_g000004 Rmu_sc0010418.1_g000008 Rmu_sc0016104.1_g000004 Rmu_sc0022792.1_g000002 Rmu_sc0030012.1_g000001
rosa_roxburghii Rroxscaffold_3G00248640 Rroxscaffold_3G00258060 Rroxscaffold_4G00284630 Rroxscaffold_4G00291560 Rroxscaffold_7G00172250 Rroxscaffold_7G00176870 Rroxscaffold_7G00176900 Rroxscaffold_7G00176910 Rroxscaffold_7G00179370 Rroxscaffold_7G00181120 Rroxscaffold_7G00181140 Rroxscaffold_7G00181220
rosa_rugosa Rorug01G0324600 Rorug01G0324900 Rorug05G0130400 Rorug06G0191400 Rorug06G0191700 Rorug06G0192000 Rorug06G0192100 Rorug06G0199500 Rorug06G0199600 Rorug06G0210400 Rorug06G0213400 Rorug07G0044900
rosa_samantha Rh1BG289300 Rh5CG250500 Rh6DG111000 Rh6DG299100 Rh6DG299400 Rh6DG299700 Rh6DG300000 Rh6DG324600 Rh7BG171300
rosa_wichuraiana Rw0G015350 Rw1G029080 Rw1G029600 Rw5G020460 Rw6G026040 Rw6G028110 Rw6G028120 Rw6G028150 Rw6G031990 Rw7G014690 Rw7G014700 Rw7G015310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 730
AciI CCGC 2 cut(s) 45, 387
AclWI GGATC 1 cut(s) 533
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 398, 491
AfaI GTAC 4 cut(s) 233, 459, 556, 854
AflII CTTAAG 1 cut(s) 173
AgsI TTSAA 6 cut(s) 262, 536, 602, 689, 952, 1013
AjnI CCWGG 2 cut(s) 95, 580
AluBI AGCT 3 cut(s) 241, 283, 664
AluI AGCT 3 cut(s) 241, 283, 664
Alw26I GTCTC 1 cut(s) 977
AlwI GGATC 1 cut(s) 533
Ama87I CYCGRG 1 cut(s) 72
AoxI GGCC 2 cut(s) 3, 505
ApaI GGGCCC 1 cut(s) 509
ApeKI GCWGC 3 cut(s) 47, 283, 661
ApoI RAATTY 2 cut(s) 398, 491
AspS9I GGNCC 3 cut(s) 505, 506, 569
AsuHPI GGTGA 2 cut(s) 229, 815
AvaI CYCGRG 1 cut(s) 72
AvaII GGWCC 1 cut(s) 569
BaeGI GKGCMC 1 cut(s) 509
BaeI ACNNNNGTAYC 2 cut(s) 99, 132
BanI GGYRCC 1 cut(s) 730
BanII GRGCYC 1 cut(s) 509
BauI CACGAG 1 cut(s) 60
BbvI GCAGC 3 cut(s) 59, 270, 673
BccI CCATC 7 cut(s) 133, 204, 320, 364, 713, 800, 901
BcgI CGANNNNNNTGC 2 cut(s) 861, 895
BciT130I CCWGG 2 cut(s) 97, 582
BciVI GTATCC 2 cut(s) 100, 689
BcoDI GTCTC 1 cut(s) 977
BfaI CTAG 1 cut(s) 410
BfmI CTRYAG 1 cut(s) 403
BfrI CTTAAG 1 cut(s) 173
BfuI GTATCC 2 cut(s) 100, 689
BisI GCNGC 4 cut(s) 48, 284, 388, 662
BlsI GCNGC 4 cut(s) 49, 285, 389, 663
Bme1390I CCNGG 2 cut(s) 97, 582
Bme18I GGWCC 1 cut(s) 569
BmeT110I CYCGRG 1 cut(s) 72
BmgT120I GGNCC 3 cut(s) 505, 506, 569
BmiI GGNNCC 2 cut(s) 507, 732
BmrFI CCNGG 2 cut(s) 97, 582
BmsI GCATC 1 cut(s) 817
BpmI CTGGAG 1 cut(s) 225
Bpu10I CCTNAGC 1 cut(s) 543
BsaAI YACGTR 1 cut(s) 554
BsaJI CCNNGG 2 cut(s) 95, 580
Bse3DI GCAATG 1 cut(s) 80
BseBI CCWGG 2 cut(s) 97, 582
BseDI CCNNGG 2 cut(s) 95, 580
BseGI GGATG 3 cut(s) 215, 312, 335
BseMI GCAATG 1 cut(s) 80
BseMII CTCAG 1 cut(s) 111
BseSI GKGCMC 1 cut(s) 509
BseXI GCAGC 3 cut(s) 59, 270, 673
BshFI GGCC 2 cut(s) 5, 507
BshNI GGYRCC 1 cut(s) 730
BsiHKCI CYCGRG 1 cut(s) 72
BsiWI CGTACG 1 cut(s) 554
BsmAI GTCTC 1 cut(s) 977
BsnI GGCC 2 cut(s) 5, 507
BsoBI CYCGRG 1 cut(s) 72
Bsp120I GGGCCC 1 cut(s) 505
Bsp1286I GDGCHC 1 cut(s) 509
Bsp143I GATC 5 cut(s) 244, 469, 538, 900, 936
BspACI CCGC 2 cut(s) 45, 387
BspANI GGCC 2 cut(s) 5, 507
BspCNI CTCAG 1 cut(s) 112
BspHI TCATGA 1 cut(s) 268
BspLI GGNNCC 2 cut(s) 507, 732
BspPI GGATC 1 cut(s) 533
BspT107I GGYRCC 1 cut(s) 730
BspTI CTTAAG 1 cut(s) 173
BsrDI GCAATG 1 cut(s) 80
BssECI CCNNGG 2 cut(s) 95, 580
BssMI GATC 5 cut(s) 244, 469, 538, 900, 936
BssSI CACGAG 1 cut(s) 60
Bst2BI CACGAG 1 cut(s) 60
Bst2UI CCWGG 2 cut(s) 97, 582
Bst4CI ACNGT 3 cut(s) 55, 115, 457
BstAFI CTTAAG 1 cut(s) 173
BstBAI YACGTR 1 cut(s) 554
BstC8I GCNNGC 2 cut(s) 549, 631
BstDEI CTNAG 4 cut(s) 120, 294, 543, 590
BstF5I GGATG 3 cut(s) 215, 312, 335
BstKTI GATC 5 cut(s) 247, 472, 541, 903, 939
BstMAI GTCTC 1 cut(s) 977
BstMBI GATC 5 cut(s) 244, 469, 538, 900, 936
BstMWI GCNNNNNNNGC 1 cut(s) 247
BstNI CCWGG 2 cut(s) 97, 582
BstSCI CCNGG 2 cut(s) 95, 580
BstSFI CTRYAG 1 cut(s) 403
BstSLI GKGCMC 1 cut(s) 509
BstV1I GCAGC 3 cut(s) 59, 270, 673
BstX2I RGATCY 1 cut(s) 538
BstXI CCANNNNNNTGG 1 cut(s) 799
BstYI RGATCY 1 cut(s) 538
BsuI GTATCC 2 cut(s) 100, 689
BsuRI GGCC 2 cut(s) 5, 507
BtsCI GGATG 3 cut(s) 215, 312, 335
BtsIMutI CAGTG 1 cut(s) 117
Cac8I GCNNGC 2 cut(s) 549, 631
CciI TCATGA 1 cut(s) 268
Cfr13I GGNCC 3 cut(s) 505, 506, 569
Csp6I GTAC 4 cut(s) 232, 458, 555, 853
CspCI CAANNNNNGTGG 2 cut(s) 984, 1019
CviAII CATG 4 cut(s) 269, 885, 922, 980
CviQI GTAC 4 cut(s) 232, 458, 555, 853
DdeI CTNAG 4 cut(s) 120, 294, 543, 590
DpnI GATC 5 cut(s) 246, 471, 540, 902, 938
DpnII GATC 5 cut(s) 244, 469, 538, 900, 936
EaeI YGGCCR 1 cut(s) 3
Eco24I GRGCYC 1 cut(s) 509
Eco47I GGWCC 1 cut(s) 569
Eco88I CYCGRG 1 cut(s) 72
EcoO109I RGGNCCY 1 cut(s) 506
EcoRI GAATTC 1 cut(s) 398
EcoRII CCWGG 2 cut(s) 95, 580
EcoT38I GRGCYC 1 cut(s) 509
FaeI CATG 4 cut(s) 272, 888, 925, 983
FatI CATG 4 cut(s) 268, 884, 921, 979
FauI CCCGC 1 cut(s) 52
Fnu4HI GCNGC 4 cut(s) 48, 284, 388, 662
FokI GGATG 3 cut(s) 222, 299, 322
FriOI GRGCYC 1 cut(s) 509
Fsp4HI GCNGC 4 cut(s) 48, 284, 388, 662
FspBI CTAG 1 cut(s) 410
GluI GCNGC 4 cut(s) 48, 284, 388, 662
GsuI CTGGAG 1 cut(s) 225
HaeIII GGCC 2 cut(s) 5, 507
Hin1II CATG 4 cut(s) 272, 888, 925, 983
HincII GTYRAC 1 cut(s) 40
HindII GTYRAC 1 cut(s) 40
HphI GGTGA 2 cut(s) 229, 815
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 5 cut(s) 229, 351, 358, 766, 845
Hpy188III TCNNGA 8 cut(s) 26, 62, 204, 269, 448, 572, 599, 904
Hpy8I GTNNAC 1 cut(s) 40
Hpy99I CGWCG 3 cut(s) 16, 686, 827
HpyAV CCTTC 5 cut(s) 97, 354, 596, 826, 958
HpyCH4III ACNGT 3 cut(s) 55, 115, 457
HpyCH4IV ACGT 3 cut(s) 11, 553, 684
HpyCH4V TGCA 3 cut(s) 363, 713, 872
HpyF10VI GCNNNNNNNGC 1 cut(s) 247
HpyF3I CTNAG 4 cut(s) 120, 294, 543, 590
HpySE526I ACGT 3 cut(s) 11, 553, 684
Hsp92II CATG 4 cut(s) 272, 888, 925, 983
Kzo9I GATC 5 cut(s) 244, 469, 538, 900, 936
Lsp1109I GCAGC 3 cut(s) 59, 270, 673
LweI GCATC 1 cut(s) 817
MaeI CTAG 1 cut(s) 410
MaeII ACGT 3 cut(s) 11, 553, 684
MaeIII GTNAC 4 cut(s) 115, 217, 527, 740
MalI GATC 5 cut(s) 246, 471, 540, 902, 938
MboI GATC 5 cut(s) 244, 469, 538, 900, 936
MboII GAAGA 7 cut(s) 14, 112, 189, 192, 548, 787, 905
MfeI CAATTG 1 cut(s) 856
MflI RGATCY 1 cut(s) 538
MhlI GDGCHC 1 cut(s) 509
MluCI AATT 7 cut(s) 182, 307, 392, 398, 491, 561, 856
MlyI GAGTC 5 cut(s) 214, 604, 755, 855, 979
MmeI TCCRAC 1 cut(s) 374
MnlI CCTC 4 cut(s) 200, 686, 721, 841
MseI TTAA 3 cut(s) 174, 918, 1030
MslI CAYNNNNRTG 1 cut(s) 368
MspCI CTTAAG 1 cut(s) 173
MspR9I CCNGG 2 cut(s) 97, 582
MunI CAATTG 1 cut(s) 856
MvaI CCWGG 2 cut(s) 97, 582
MwoI GCNNNNNNNGC 1 cut(s) 247
NdeII GATC 5 cut(s) 244, 469, 538, 900, 936
NlaIII CATG 4 cut(s) 272, 888, 925, 983
NlaIV GGNNCC 2 cut(s) 507, 732
NmuCI GTSAC 3 cut(s) 115, 217, 527
PaeR7I CTCGAG 1 cut(s) 72
PagI TCATGA 1 cut(s) 268
PcsI WCGNNNNNNNCGW 1 cut(s) 936
PfeI GAWTC 6 cut(s) 262, 290, 623, 669, 878, 1009
Pfl23II CGTACG 1 cut(s) 554
PkrI GCNGC 4 cut(s) 49, 285, 389, 663
PleI GAGTC 5 cut(s) 214, 603, 755, 854, 979
PpsI GAGTC 5 cut(s) 214, 603, 755, 854, 979
Ppu21I YACGTR 1 cut(s) 554
Psp6I CCWGG 2 cut(s) 95, 580
PspGI CCWGG 2 cut(s) 95, 580
PspLI CGTACG 1 cut(s) 554
PspN4I GGNNCC 2 cut(s) 507, 732
PspOMI GGGCCC 1 cut(s) 505
PspPI GGNCC 3 cut(s) 505, 506, 569
PspXI VCTCGAGB 1 cut(s) 72
PsuI RGATCY 1 cut(s) 538
RsaI GTAC 4 cut(s) 233, 459, 556, 854
RsaNI GTAC 4 cut(s) 232, 458, 555, 853
RseI CAYNNNNRTG 1 cut(s) 368
SaqAI TTAA 3 cut(s) 174, 918, 1030
SatI GCNGC 4 cut(s) 48, 284, 388, 662
Sau3AI GATC 5 cut(s) 244, 469, 538, 900, 936
Sau96I GGNCC 3 cut(s) 505, 506, 569
SchI GAGTC 5 cut(s) 214, 604, 755, 855, 979
ScrFI CCNGG 2 cut(s) 97, 582
SduI GDGCHC 1 cut(s) 509
SetI ASST 8 cut(s) 14, 243, 285, 556, 666, 687, 732, 1021
SfaNI GCATC 1 cut(s) 817
SfcI CTRYAG 1 cut(s) 403
Sfr274I CTCGAG 1 cut(s) 72
SinI GGWCC 1 cut(s) 569
SlaI CTCGAG 1 cut(s) 72
SmiMI CAYNNNNRTG 1 cut(s) 368
SmlI CTYRAG 2 cut(s) 72, 173
SmoI CTYRAG 2 cut(s) 72, 173
Sse9I AATT 7 cut(s) 182, 307, 392, 398, 491, 561, 856
SsiI CCGC 2 cut(s) 45, 387
SspMI CTAG 1 cut(s) 410
StyD4I CCNGG 2 cut(s) 95, 580
TaaI ACNGT 3 cut(s) 55, 115, 457
TaiI ACGT 3 cut(s) 14, 556, 687
TasI AATT 7 cut(s) 182, 307, 392, 398, 491, 561, 856
TatI WGTACW 2 cut(s) 231, 852
TauI GCSGC 1 cut(s) 390
TfiI GAWTC 6 cut(s) 262, 290, 623, 669, 878, 1009
Tru1I TTAA 3 cut(s) 174, 918, 1030
Tru9I TTAA 3 cut(s) 174, 918, 1030
TscAI CASTG 1 cut(s) 124
TseFI GTSAC 3 cut(s) 115, 217, 527
TseI GCWGC 3 cut(s) 47, 283, 661
Tsp45I GTSAC 3 cut(s) 115, 217, 527
TspDTI ATGAA 2 cut(s) 432, 938
TspGWI ACGGA 2 cut(s) 811, 945
TspRI CASTG 1 cut(s) 124
Vha464I CTTAAG 1 cut(s) 173
VpaK11BI GGWCC 1 cut(s) 569
XapI RAATTY 2 cut(s) 398, 491
XcmI CCANNNNNNNNNTGG 1 cut(s) 1002
XhoI CTCGAG 1 cut(s) 72
XspI CTAG 1 cut(s) 410
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.