Rh6DG324600

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
52882404 .. 52896184
13781 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG324600.1

Sequence Viewer

Length: 210 bp
ATGAAGCGCAATTGGTCCAAGGATCTCCCTGAAGATCTTATCATCTTTGTCGCCAAATGGCTATGTTCCTTGGAAGATTTTATTTTTTTCGGTGCAGTTTGCAGATCATGGAGATCAGCCACGACGAAGCTGGCAAAGGAGAAAAAATATACGAATACTACTGTCCTCTATGGGCCTAGCCGTCAATTTGTTGTGAGCGCGGGAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.96

Weight (kDa)

9.56

Isoelectric Point (pI)

36.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000399)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g21230 FvH4_2g22763 FvH4_2g23250 FvH4_3g19214 FvH4_5g01761 FvH4_5g02180 FvH4_5g23981 FvH4_7g21350 FvH4_7g21590
malus_domestica MD00G1040400.v1.1 MD00G1057500.v1.1 MD05G1079000.v1.1 MD05G1357500.v1.1 MD05G1357800.v1.1
prunus_persica Prupe.4G213300_v2.0.a1 Prupe.8G190800_v2.0.a1 Prupe.8G190900_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0372911 RchiOBHm_Chr5g0006331 RchiOBHm_Chr5g0032291 RchiOBHm_Chr6g0287741 RchiOBHm_Chr6g0287791 RchiOBHm_Chr6g0289281 RchiOBHm_Chr6g0290581 RchiOBHm_Chr6g0290601 RchiOBHm_Chr7g0210061
rosa_laevigata RLG00000003898 RLG00000004101 RLG00000012190 RLG00000012194 RLG00000012196 RLG00000012198 RLG00000012199 RLG00000012200 RLG00000012278 RLG00000012316 RLG00000012346 RLG00000012468 RLG00000027389 RLG00000033378
rosa_multiflora Rmu_sc0000366.1_g000019 Rmu_sc0001082.1_g000011 Rmu_sc0001105.1_g000009 Rmu_sc0002290.1_g000001 Rmu_sc0003335.1_g000005 Rmu_sc0003335.1_g000007 Rmu_sc0003877.1_g000009 Rmu_sc0003877.1_g000011 Rmu_sc0004311.1_g000002 Rmu_sc0006266.1_g000019 Rmu_sc0006802.1_g000001 Rmu_sc0008789.1_g000004 Rmu_sc0010418.1_g000008 Rmu_sc0016104.1_g000004 Rmu_sc0022792.1_g000002 Rmu_sc0030012.1_g000001
rosa_roxburghii Rroxscaffold_3G00248640 Rroxscaffold_3G00258060 Rroxscaffold_4G00284630 Rroxscaffold_4G00291560 Rroxscaffold_7G00172250 Rroxscaffold_7G00176870 Rroxscaffold_7G00176900 Rroxscaffold_7G00176910 Rroxscaffold_7G00179370 Rroxscaffold_7G00181120 Rroxscaffold_7G00181140 Rroxscaffold_7G00181220
rosa_rugosa Rorug01G0324600 Rorug01G0324900 Rorug05G0130400 Rorug06G0191400 Rorug06G0191700 Rorug06G0192000 Rorug06G0192100 Rorug06G0199500 Rorug06G0199600 Rorug06G0210400 Rorug06G0213400 Rorug07G0044900
rosa_samantha Rh1BG289300 Rh5CG250500 Rh6DG111000 Rh6DG299100 Rh6DG299400 Rh6DG299700 Rh6DG300000 Rh6DG324600 Rh7BG171300
rosa_wichuraiana Rw0G015350 Rw1G029080 Rw1G029600 Rw5G020460 Rw6G026040 Rw6G028110 Rw6G028120 Rw6G028150 Rw6G031990 Rw7G014690 Rw7G014700 Rw7G015310

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 200
AciI CCGC 1 cut(s) 200
AclWI GGATC 1 cut(s) 30
AcuI CTGAAG 1 cut(s) 51
AluBI AGCT 1 cut(s) 130
AluI AGCT 1 cut(s) 130
AlwI GGATC 1 cut(s) 30
AoxI GGCC 1 cut(s) 173
AspLEI GCGC 2 cut(s) 9, 200
AspS9I GGNCC 2 cut(s) 15, 173
AvaII GGWCC 1 cut(s) 15
BceAI ACGGC 1 cut(s) 165
BfaI CTAG 1 cut(s) 177
BglII AGATCT 1 cut(s) 34
Bme18I GGWCC 1 cut(s) 15
BmgT120I GGNCC 2 cut(s) 15, 173
BsaJI CCNNGG 2 cut(s) 18, 69
BseDI CCNNGG 2 cut(s) 18, 69
BsgI GTGCAG 1 cut(s) 114
Bsh1236I CGCG 1 cut(s) 200
BshFI GGCC 1 cut(s) 175
BsnI GGCC 1 cut(s) 175
Bsp143I GATC 4 cut(s) 22, 34, 104, 113
BspACI CCGC 1 cut(s) 200
BspANI GGCC 1 cut(s) 175
BspFNI CGCG 1 cut(s) 200
BspPI GGATC 1 cut(s) 30
BssECI CCNNGG 2 cut(s) 18, 69
BssMI GATC 4 cut(s) 22, 34, 104, 113
BssT1I CCWWGG 2 cut(s) 18, 69
Bst4CI ACNGT 1 cut(s) 163
BstC8I GCNNGC 1 cut(s) 132
BstFNI CGCG 1 cut(s) 200
BstHHI GCGC 2 cut(s) 9, 200
BstKTI GATC 4 cut(s) 25, 37, 107, 116
BstMBI GATC 4 cut(s) 22, 34, 104, 113
BstUI CGCG 1 cut(s) 200
BstX2I RGATCY 2 cut(s) 22, 34
BstYI RGATCY 2 cut(s) 22, 34
BsuRI GGCC 1 cut(s) 175
Cac8I GCNNGC 1 cut(s) 132
CfoI GCGC 2 cut(s) 9, 200
Cfr13I GGNCC 2 cut(s) 15, 173
CviAII CATG 1 cut(s) 108
CviJI RGCY 5 cut(s) 61, 119, 130, 175, 180
CviKI_1 RGCY 5 cut(s) 61, 119, 130, 175, 180
DpnI GATC 4 cut(s) 24, 36, 106, 115
DpnII GATC 4 cut(s) 22, 34, 104, 113
Eco130I CCWWGG 2 cut(s) 18, 69
Eco47I GGWCC 1 cut(s) 15
Eco57I CTGAAG 1 cut(s) 51
EcoT14I CCWWGG 2 cut(s) 18, 69
ErhI CCWWGG 2 cut(s) 18, 69
FaeI CATG 1 cut(s) 111
FaiI YATR 4 cut(s) 64, 109, 150, 171
FatI CATG 1 cut(s) 107
FauI CCCGC 1 cut(s) 193
FspBI CTAG 1 cut(s) 177
GlaI GCGC 2 cut(s) 8, 199
HaeIII GGCC 1 cut(s) 175
HhaI GCGC 2 cut(s) 9, 200
Hin1II CATG 1 cut(s) 111
Hin6I GCGC 2 cut(s) 7, 198
HinP1I GCGC 2 cut(s) 7, 198
Hpy99I CGWCG 1 cut(s) 127
HpyCH4III ACNGT 1 cut(s) 163
HpyCH4V TGCA 2 cut(s) 95, 102
Hsp92II CATG 1 cut(s) 111
HspAI GCGC 2 cut(s) 7, 198
Kzo9I GATC 4 cut(s) 22, 34, 104, 113
LpnPI CCDG 2 cut(s) 42, 116
MaeI CTAG 1 cut(s) 177
MalI GATC 4 cut(s) 24, 36, 106, 115
MboI GATC 4 cut(s) 22, 34, 104, 113
MboII GAAGA 2 cut(s) 44, 86
MfeI CAATTG 1 cut(s) 10
MflI RGATCY 2 cut(s) 22, 34
MluCI AATT 3 cut(s) 10, 185, 205
MnlI CCTC 1 cut(s) 176
MunI CAATTG 1 cut(s) 10
MvnI CGCG 1 cut(s) 200
NdeII GATC 4 cut(s) 22, 34, 104, 113
NlaIII CATG 1 cut(s) 111
PspPI GGNCC 2 cut(s) 15, 173
PsuI RGATCY 2 cut(s) 22, 34
Sau3AI GATC 4 cut(s) 22, 34, 104, 113
Sau96I GGNCC 2 cut(s) 15, 173
SetI ASST 1 cut(s) 132
SgeI CNNG 7 cut(s) 31, 41, 82, 120, 133, 143, 189
SinI GGWCC 1 cut(s) 15
Sse9I AATT 3 cut(s) 10, 185, 205
SsiI CCGC 1 cut(s) 200
SspMI CTAG 1 cut(s) 177
StyI CCWWGG 2 cut(s) 18, 69
TaaI ACNGT 1 cut(s) 163
TasI AATT 3 cut(s) 10, 185, 205
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 15
XcmI CCANNNNNNNNNTGG 1 cut(s) 127
XspI CTAG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.