RchiOBHm_Chr3g0465681

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0000421
Physical Location & Seq
Reverse (-)
12386753 .. 12388478
1726 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43182

Sequence Viewer

Length: 165 bp
ATGGATACGGGTACGATACGCACTAGGAAGATGAGCGATGCAATTGTAGTTTATGGAGGCATTCTTGAGGTTGCCAACCTCTCTCTTGATAAACCGGAATTGGAGGGTGTAATCTTTGATGATGAGGATGAACTTCAGCTGAGGCGTTTGATTTCAAGCTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF659 Dimer_Tnp_hAT

Protein Analysis

54

Amino Acids

6.03

Weight (kDa)

4.34

Isoelectric Point (pI)

53.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000421)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G08267
fragaria_vesca FvH4_2g14331 FvH4_2g16371 FvH4_2g26163 FvH4_3g42540 FvH4_4g02102 FvH4_4g12491 FvH4_4g35171 FvH4_5g06632 FvH4_5g06632 FvH4_5g06632 FvH4_5g08811 FvH4_5g08812 FvH4_5g23531 FvH4_6g10272 FvH4_6g40844 FvH4_7g16803 FvH4_7g16804
malus_domestica MD11G1099500.v1.1 MD17G1176800.v1.1
pyrus_communis pycom05g07840 pycom06g08730 pycom07g12010 pycom07g12020 pycom10g07270 pycom11g17470 pycom12g10610 pycom12g14240 pycom13g22040 pycom15g02440
rosa_chinensis RchiOBHm_Chr1g0371321 RchiOBHm_Chr2g0102701 RchiOBHm_Chr3g0465681 RchiOBHm_Chr4g0420941 RchiOBHm_Chr4g0434271 RchiOBHm_Chr4g0442721 RchiOBHm_Chr6g0262081 RchiOBHm_Chr6g0278171 RchiOBHm_Chr6g0294991 RchiOBHm_Chr6g0295001 RchiOBHm_Chr7g0205361 RchiOBHm_Chr7g0205371 RchiOBHm_Chr7g0223471
rosa_laevigata RLG00000005266
rosa_multiflora Rmu_sc0000493.1_g000033 Rmu_sc0000493.1_g000034 Rmu_sc0000507.1_g000007 Rmu_sc0000843.1_g000001 Rmu_sc0001075.1_g000033 Rmu_sc0002077.1_g000007 Rmu_sc0002077.1_g000008 Rmu_sc0002329.1_g000029 Rmu_sc0002539.1_g000077 Rmu_sc0002655.1_g000006 Rmu_sc0003127.1_g000020 Rmu_sc0003765.1_g000054 Rmu_sc0004368.1_g000023 Rmu_sc0004753.1_g000022 Rmu_sc0005297.1_g000014 Rmu_sc0007633.1_g000010 Rmu_sc0008164.1_g000005 Rmu_sc0008191.1_g000003 Rmu_sc0017900.1_g000005 Rmu_sc0022727.1_g000002
rosa_roxburghii Rroxscaffold_2G00079920 Rroxscaffold_3G00255890 Rroxscaffold_4G00295340 Rroxscaffold_4G00296360 Rroxscaffold_4G00299640 Rroxscaffold_6G00388210
rosa_rugosa Rorug02G0466700 Rorug04G0123200 Rorug05G0074800 Rorug07G0202900
rosa_samantha Rh1DG134700 Rh3CG159000 Rh4AG331000 Rh5AG521100 Rh5BG136400 Rh5DG127300 Rh5DG383100 Rh5DG386100 Rh5DG458000 Rh6CG450400 Rh7CG233800 Rh7DG407100
rosa_wichuraiana Rw1G004960 Rw1G005730 Rw1G006360 Rw1G017400 Rw2G013190 Rw2G022210 Rw2G029640 Rw5G020910 Rw5G036930 Rw6G016200 Rw7G018170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 119
AfaI GTAC 1 cut(s) 13
AgsI TTSAA 1 cut(s) 156
AluBI AGCT 2 cut(s) 139, 159
AluI AGCT 2 cut(s) 139, 159
BbvCI CCTCAGC 1 cut(s) 140
BfaI CTAG 1 cut(s) 24
BmsI GCATC 1 cut(s) 28
Bpu10I CCTNAGC 1 cut(s) 140
BpuEI CTTGAG 1 cut(s) 86
BsaWI WCCGGW 1 cut(s) 94
BseGI GGATG 1 cut(s) 133
BseMII CTCAG 1 cut(s) 131
BsiSI CCGG 1 cut(s) 95
BsmI GAATGC 1 cut(s) 60
BspCNI CTCAG 1 cut(s) 132
BstDEI CTNAG 1 cut(s) 140
BstF5I GGATG 1 cut(s) 133
BtgZI GCGATG 1 cut(s) 51
BtsCI GGATG 1 cut(s) 133
Csp6I GTAC 1 cut(s) 12
CviJI RGCY 2 cut(s) 139, 159
CviKI_1 RGCY 2 cut(s) 139, 159
CviQI GTAC 1 cut(s) 12
DdeI CTNAG 1 cut(s) 140
Eco57I CTGAAG 1 cut(s) 119
FaiI YATR 1 cut(s) 54
FokI GGATG 1 cut(s) 140
FspBI CTAG 1 cut(s) 24
HapII CCGG 1 cut(s) 95
HpaII CCGG 1 cut(s) 95
Hpy188III TCNNGA 2 cut(s) 65, 86
HpyCH4V TGCA 1 cut(s) 41
HpyF3I CTNAG 1 cut(s) 140
LpnPI CCDG 1 cut(s) 108
LweI GCATC 1 cut(s) 28
MaeI CTAG 1 cut(s) 24
MboII GAAGA 1 cut(s) 40
MfeI CAATTG 1 cut(s) 42
MluCI AATT 2 cut(s) 42, 98
MnlI CCTC 6 cut(s) 50, 61, 89, 97, 118, 135
MspA1I CMGCKG 1 cut(s) 139
MspI CCGG 1 cut(s) 95
MunI CAATTG 1 cut(s) 42
Mva1269I GAATGC 1 cut(s) 60
PctI GAATGC 1 cut(s) 60
PvuII CAGCTG 1 cut(s) 139
RsaI GTAC 1 cut(s) 13
RsaNI GTAC 1 cut(s) 12
SetI ASST 4 cut(s) 72, 81, 141, 161
SfaNI GCATC 1 cut(s) 28
SgeI CNNG 5 cut(s) 21, 36, 77, 98, 107
SmlI CTYRAG 1 cut(s) 65
SmoI CTYRAG 1 cut(s) 65
Sse9I AATT 2 cut(s) 42, 98
SspMI CTAG 1 cut(s) 24
TasI AATT 2 cut(s) 42, 98
TspDTI ATGAA 1 cut(s) 144
XspI CTAG 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.