Rw1G004960

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
OG0000421
Physical Location & Seq
Forward (+)
9483412 .. 9485201
1790 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G004960.1

Sequence Viewer

Length: 1251 bp
ATGATAAAGCACCATTGTGGAAATTTTTTGCAACAAGGTTACTCCTCATTGTCCAAGTTGGTGAGAGAATGCAAGGAGAGACTAATGAATACATCTCCTAAACAAGTTCCTCTACCATCATCAAGATCATCAAGACAGCAAGGGGGGAGTTCTGCCACAAGTAGCTATGGGATGAGTTATCATGCCTATACACAAGCACAAACAGCAAGTGATGGTGGAAAGAAGAGGAAAACAGTTGCTGGTTCAGTTGAAAAGGCCTTCCAAAACTCAGCTAGGGAGCAATGCGATACTAGAAATCCACACTATCGGAACTCCTACATTCGTGCTTCTACCCTTCCAGGCTACATTCCACCAGGCTACAATGCTCTAAGGACCACACTTCTTGCAAAAGAAAGGAAAAATATTGAGCATCATCTAGATCTTTGTAGTGATGGTTGGTCTGATGCACAAAGAATACCATTGATTAATGTGATAGCCACTTGTGAGAGTGGTCCGATGATGTTGAGGGCTATAAACTGTGAGGGGGAATTCAAGGATCATGCATTGATTGCAGACTTGATTATAGATTCCATCAAGGAAGTGGGTTGGGAAAATGTTGTGCAAGTGATTACCGACAATGCTCCTGTTTGTTCCAAGGTCAGTGCCTTGATAGCAATGATGTTTAATGACCATTGCAATTTGAAGTTGCTTTCGGTTGCTCCCACAAGGTTTGCATCTACGTTAATCATGCTAAAGAGGTTTAGGCAAATCAAAAATGGTTTGCAACAGATGGTCATCAGTCCAAAGTGGGATGATTACAAAGAAGATGATTTGTTGTGGGATGACATTGATTACATCATTTCTTTTATTGAGCCTATCTATGAGATGATCAGGAGAGTAGACACTGATAGGCCTTCTCTTCATTTGGTGTATGAATGGTGGGATAGTATGATTGAGCAAGTGAAGAAAGCTATCTATAGGAAAGAAAGGAAGCAACCTCATCAAGAGTCTCCATTTCGGGATGCGGTGTATAAGGTTCTAATGGCTCGTTGGTCCAAGAGCAATACTTCTCTCAATTGCTTGGCACATTCATTGAATCCGAATGAAAATACTAATCGGGTTGCTCCCCACAAAGATTTAGAGATTACAAGGGAGAGGAAAAATTGTATCCTTAGATACTTTGTCAATGAAGATGATCGAAGGAAAGTTAACATAGAATTTGCCAATTTTTCTATGTGCATGCAAGAGTTTGGAAGTGGAGATGCTATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF659 Dimer_Tnp_hAT

Protein Analysis

416

Amino Acids

47.74

Weight (kDa)

8.73

Isoelectric Point (pI)

43.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF659 PF04937 133 - 221 2.6e-19 Domain of unknown function (DUF659)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000421)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G08267
fragaria_vesca FvH4_2g14331 FvH4_2g16371 FvH4_2g26163 FvH4_3g42540 FvH4_4g02102 FvH4_4g12491 FvH4_4g35171 FvH4_5g06632 FvH4_5g06632 FvH4_5g06632 FvH4_5g08811 FvH4_5g08812 FvH4_5g23531 FvH4_6g10272 FvH4_6g40844 FvH4_7g16803 FvH4_7g16804
malus_domestica MD11G1099500.v1.1 MD17G1176800.v1.1
pyrus_communis pycom05g07840 pycom06g08730 pycom07g12010 pycom07g12020 pycom10g07270 pycom11g17470 pycom12g10610 pycom12g14240 pycom13g22040 pycom15g02440
rosa_chinensis RchiOBHm_Chr1g0371321 RchiOBHm_Chr2g0102701 RchiOBHm_Chr3g0465681 RchiOBHm_Chr4g0420941 RchiOBHm_Chr4g0434271 RchiOBHm_Chr4g0442721 RchiOBHm_Chr6g0262081 RchiOBHm_Chr6g0278171 RchiOBHm_Chr6g0294991 RchiOBHm_Chr6g0295001 RchiOBHm_Chr7g0205361 RchiOBHm_Chr7g0205371 RchiOBHm_Chr7g0223471
rosa_laevigata RLG00000005266
rosa_multiflora Rmu_sc0000493.1_g000033 Rmu_sc0000493.1_g000034 Rmu_sc0000507.1_g000007 Rmu_sc0000843.1_g000001 Rmu_sc0001075.1_g000033 Rmu_sc0002077.1_g000007 Rmu_sc0002077.1_g000008 Rmu_sc0002329.1_g000029 Rmu_sc0002539.1_g000077 Rmu_sc0002655.1_g000006 Rmu_sc0003127.1_g000020 Rmu_sc0003765.1_g000054 Rmu_sc0004368.1_g000023 Rmu_sc0004753.1_g000022 Rmu_sc0005297.1_g000014 Rmu_sc0007633.1_g000010 Rmu_sc0008164.1_g000005 Rmu_sc0008191.1_g000003 Rmu_sc0017900.1_g000005 Rmu_sc0022727.1_g000002
rosa_roxburghii Rroxscaffold_2G00079920 Rroxscaffold_3G00255890 Rroxscaffold_4G00295340 Rroxscaffold_4G00296360 Rroxscaffold_4G00299640 Rroxscaffold_6G00388210
rosa_rugosa Rorug02G0466700 Rorug04G0123200 Rorug05G0074800 Rorug07G0202900
rosa_samantha Rh1DG134700 Rh3CG159000 Rh4AG331000 Rh5AG521100 Rh5BG136400 Rh5DG127300 Rh5DG383100 Rh5DG386100 Rh5DG458000 Rh6CG450400 Rh7CG233800 Rh7DG407100
rosa_wichuraiana Rw1G004960 Rw1G005730 Rw1G006360 Rw1G017400 Rw2G013190 Rw2G022210 Rw2G029640 Rw5G020910 Rw5G036930 Rw6G016200 Rw7G018170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 879
AciI CCGC 1 cut(s) 1004
AclWI GGATC 1 cut(s) 543
AcsI RAATTY 3 cut(s) 22, 527, 1196
AgsI TTSAA 4 cut(s) 251, 532, 682, 1075
AjnI CCWGG 2 cut(s) 337, 352
AleI CACNNNNGTG 1 cut(s) 15
AluBI AGCT 3 cut(s) 165, 272, 950
AluI AGCT 3 cut(s) 165, 272, 950
Alw26I GTCTC 2 cut(s) 73, 993
AlwI GGATC 1 cut(s) 543
AlwNI CAGNNNCTG 1 cut(s) 239
AoxI GGCC 2 cut(s) 255, 890
ApoI RAATTY 3 cut(s) 22, 527, 1196
AseI ATTAAT 1 cut(s) 465
AspS9I GGNCC 3 cut(s) 372, 491, 1032
AsuHPI GGTGA 1 cut(s) 73
AvaII GGWCC 3 cut(s) 372, 491, 1032
BccI CCATC 5 cut(s) 124, 206, 425, 578, 763
BciT130I CCWGG 2 cut(s) 339, 354
BciVI GTATCC 1 cut(s) 1157
BclI TGATCA 1 cut(s) 867
BcoDI GTCTC 2 cut(s) 73, 993
BfaI CTAG 3 cut(s) 273, 291, 416
BfmI CTRYAG 1 cut(s) 955
BfuI GTATCC 1 cut(s) 1157
BglII AGATCT 1 cut(s) 418
Bme1390I CCNGG 2 cut(s) 339, 354
Bme18I GGWCC 3 cut(s) 372, 491, 1032
BmgT120I GGNCC 3 cut(s) 372, 491, 1032
BmrFI CCNGG 2 cut(s) 339, 354
BmsI GCATC 5 cut(s) 418, 433, 722, 991, 1231
BsaBI GATNNNNATC 1 cut(s) 773
BsaJI CCNNGG 1 cut(s) 633
Bse3DI GCAATG 3 cut(s) 287, 660, 670
Bse8I GATNNNNATC 1 cut(s) 773
BseBI CCWGG 2 cut(s) 339, 354
BseDI CCNNGG 1 cut(s) 633
BseGI GGATG 4 cut(s) 177, 796, 826, 1006
BseJI GATNNNNATC 1 cut(s) 773
BseMI GCAATG 3 cut(s) 287, 660, 670
BseMII CTCAG 1 cut(s) 282
BseRI GAGGAG 1 cut(s) 34
BshFI GGCC 2 cut(s) 257, 892
BsmAI GTCTC 2 cut(s) 73, 993
BsmI GAATGC 1 cut(s) 74
BsnI GGCC 2 cut(s) 257, 892
Bsp143I GATC 5 cut(s) 125, 418, 535, 867, 1174
BspACI CCGC 1 cut(s) 1004
BspANI GGCC 2 cut(s) 257, 892
BspCNI CTCAG 1 cut(s) 281
BspPI GGATC 1 cut(s) 543
BsrDI GCAATG 3 cut(s) 287, 660, 670
BssECI CCNNGG 1 cut(s) 633
BssMI GATC 5 cut(s) 125, 418, 535, 867, 1174
BssT1I CCWWGG 1 cut(s) 633
Bst2UI CCWGG 2 cut(s) 339, 354
Bst4CI ACNGT 2 cut(s) 235, 518
Bst6I CTCTTC 2 cut(s) 218, 903
BstAPI GCANNNNNTGC 1 cut(s) 548
BstC8I GCNNGC 1 cut(s) 1220
BstDEI CTNAG 3 cut(s) 268, 368, 1151
BstF5I GGATG 4 cut(s) 177, 796, 826, 1006
BstKTI GATC 5 cut(s) 128, 421, 538, 870, 1177
BstMAI GTCTC 2 cut(s) 73, 993
BstMBI GATC 5 cut(s) 125, 418, 535, 867, 1174
BstMWI GCNNNNNNNGC 3 cut(s) 203, 548, 650
BstNI CCWGG 2 cut(s) 339, 354
BstNSI RCATGY 1 cut(s) 1222
BstSCI CCNGG 2 cut(s) 337, 352
BstSFI CTRYAG 1 cut(s) 955
BstX2I RGATCY 1 cut(s) 418
BstYI RGATCY 1 cut(s) 418
BsuI GTATCC 1 cut(s) 1157
BsuRI GGCC 2 cut(s) 257, 892
BtsCI GGATG 4 cut(s) 177, 796, 826, 1006
BtsIMutI CAGTG 2 cut(s) 646, 882
Cac8I GCNNGC 1 cut(s) 1220
CaiI CAGNNNCTG 1 cut(s) 239
Cfr13I GGNCC 3 cut(s) 372, 491, 1032
CspCI CAANNNNNGTGG 4 cut(s) 364, 399, 691, 726
CviAII CATG 4 cut(s) 182, 539, 727, 1219
DdeI CTNAG 3 cut(s) 268, 368, 1151
DpnI GATC 5 cut(s) 127, 420, 537, 869, 1176
DpnII GATC 5 cut(s) 125, 418, 535, 867, 1174
Eam1104I CTCTTC 2 cut(s) 218, 903
EarI CTCTTC 2 cut(s) 218, 903
Eco130I CCWWGG 1 cut(s) 633
Eco147I AGGCCT 2 cut(s) 257, 892
Eco47I GGWCC 3 cut(s) 372, 491, 1032
EcoRI GAATTC 1 cut(s) 527
EcoRII CCWGG 2 cut(s) 337, 352
EcoT14I CCWWGG 1 cut(s) 633
EcoT22I ATGCAT 1 cut(s) 544
ErhI CCWWGG 1 cut(s) 633
FaeI CATG 4 cut(s) 185, 542, 730, 1222
FatI CATG 4 cut(s) 181, 538, 726, 1218
FbaI TGATCA 1 cut(s) 867
FblI GTMKAC 1 cut(s) 879
FokI GGATG 4 cut(s) 184, 803, 833, 1013
FspBI CTAG 3 cut(s) 273, 291, 416
HaeIII GGCC 2 cut(s) 257, 892
Hin1II CATG 4 cut(s) 185, 542, 730, 1222
HincII GTYRAC 1 cut(s) 1189
HindII GTYRAC 1 cut(s) 1189
HinfI GANTC 3 cut(s) 566, 986, 1075
HpaI GTTAAC 1 cut(s) 1189
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 2 cut(s) 880, 1189
Hpy188I TCNGA 4 cut(s) 309, 442, 495, 1080
Hpy188III TCNNGA 6 cut(s) 123, 132, 416, 871, 983, 998
Hpy8I GTNNAC 2 cut(s) 880, 1189
HpyAV CCTTC 4 cut(s) 268, 344, 903, 1173
HpyCH4III ACNGT 2 cut(s) 235, 518
HpyCH4IV ACGT 1 cut(s) 719
HpyF10VI GCNNNNNNNGC 3 cut(s) 203, 548, 650
HpyF3I CTNAG 3 cut(s) 268, 368, 1151
HpySE526I ACGT 1 cut(s) 719
Hsp92II CATG 4 cut(s) 185, 542, 730, 1222
Ksp22I TGATCA 1 cut(s) 867
KspAI GTTAAC 1 cut(s) 1189
Kzo9I GATC 5 cut(s) 125, 418, 535, 867, 1174
LmnI GCTCC 4 cut(s) 277, 625, 703, 1108
LpnPI CCDG 7 cut(s) 225, 324, 339, 351, 366, 636, 856
LweI GCATC 5 cut(s) 418, 433, 722, 991, 1231
MaeI CTAG 3 cut(s) 273, 291, 416
MaeII ACGT 1 cut(s) 719
MaeIII GTNAC 1 cut(s) 38
MalI GATC 5 cut(s) 127, 420, 537, 869, 1176
MboI GATC 5 cut(s) 125, 418, 535, 867, 1174
MboII GAAGA 5 cut(s) 235, 815, 890, 955, 1181
MfeI CAATTG 1 cut(s) 1054
MflI RGATCY 1 cut(s) 418
MluCI AATT 7 cut(s) 22, 527, 676, 1054, 1141, 1196, 1204
MlyI GAGTC 1 cut(s) 995
MnlI CCTC 8 cut(s) 55, 120, 219, 498, 514, 729, 987, 1128
Mph1103I ATGCAT 1 cut(s) 544
MseI TTAA 4 cut(s) 465, 663, 722, 1188
MslI CAYNNNNRTG 1 cut(s) 15
MspR9I CCNGG 2 cut(s) 339, 354
MunI CAATTG 1 cut(s) 1054
Mva1269I GAATGC 1 cut(s) 74
MvaI CCWGG 2 cut(s) 339, 354
MwoI GCNNNNNNNGC 3 cut(s) 203, 548, 650
NdeII GATC 5 cut(s) 125, 418, 535, 867, 1174
NlaIII CATG 4 cut(s) 185, 542, 730, 1222
NsiI ATGCAT 1 cut(s) 544
NspI RCATGY 1 cut(s) 1222
OliI CACNNNNGTG 1 cut(s) 15
PaeI GCATGC 1 cut(s) 1222
PceI AGGCCT 2 cut(s) 257, 892
PctI GAATGC 1 cut(s) 74
PfeI GAWTC 2 cut(s) 566, 1075
PleI GAGTC 1 cut(s) 994
PpsI GAGTC 1 cut(s) 994
PshBI ATTAAT 1 cut(s) 465
Psp6I CCWGG 2 cut(s) 337, 352
PspGI CCWGG 2 cut(s) 337, 352
PspPI GGNCC 3 cut(s) 372, 491, 1032
PstNI CAGNNNCTG 1 cut(s) 239
PsuI RGATCY 1 cut(s) 418
RseI CAYNNNNRTG 1 cut(s) 15
SaqAI TTAA 4 cut(s) 465, 663, 722, 1188
Sau3AI GATC 5 cut(s) 125, 418, 535, 867, 1174
Sau96I GGNCC 3 cut(s) 372, 491, 1032
SchI GAGTC 1 cut(s) 995
ScrFI CCNGG 2 cut(s) 339, 354
SfaNI GCATC 5 cut(s) 418, 433, 722, 991, 1231
SfcI CTRYAG 1 cut(s) 955
SinI GGWCC 3 cut(s) 372, 491, 1032
SmiMI CAYNNNNRTG 1 cut(s) 15
SphI GCATGC 1 cut(s) 1222
Sse9I AATT 7 cut(s) 22, 527, 676, 1054, 1141, 1196, 1204
SseBI AGGCCT 2 cut(s) 257, 892
SsiI CCGC 1 cut(s) 1004
SspI AATATT 1 cut(s) 403
SspMI CTAG 3 cut(s) 273, 291, 416
StuI AGGCCT 2 cut(s) 257, 892
StyD4I CCNGG 2 cut(s) 337, 352
StyI CCWWGG 1 cut(s) 633
TaaI ACNGT 2 cut(s) 235, 518
TaiI ACGT 1 cut(s) 722
TaqI TCGA 1 cut(s) 1177
TasI AATT 7 cut(s) 22, 527, 676, 1054, 1141, 1196, 1204
TfiI GAWTC 2 cut(s) 566, 1075
Tru1I TTAA 4 cut(s) 465, 663, 722, 1188
Tru9I TTAA 4 cut(s) 465, 663, 722, 1188
TscAI CASTG 2 cut(s) 646, 889
TspDTI ATGAA 6 cut(s) 101, 890, 927, 1059, 1098, 1182
TspRI CASTG 2 cut(s) 646, 889
VpaK11BI GGWCC 3 cut(s) 372, 491, 1032
VspI ATTAAT 1 cut(s) 465
XapI RAATTY 3 cut(s) 22, 527, 1196
XbaI TCTAGA 1 cut(s) 415
XceI RCATGY 1 cut(s) 1222
XcmI CCANNNNNNNNNTGG 1 cut(s) 577
XmiI GTMKAC 1 cut(s) 879
XspI CTAG 3 cut(s) 273, 291, 416
Zsp2I ATGCAT 1 cut(s) 544
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.