RchiOBHm_Chr6g0294991

Protein of unknown function (DUF 659)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0000421
Physical Location & Seq
Forward (+)
57151137 .. 57152844
1708 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ26475

Sequence Viewer

Length: 906 bp
ATGAGTGATGGAGGAACACCTCCTATTAGTTCTAGTGCCGGGTCTGTTAATGCCGGTACTAGTAGTGGAGCTGCTGATGCTGAAAATGAGATCATAGATGATAAAGCACCGTTGTGGAAATTTGTGAAGAAGATTCAAAAACGGCAAGGTGGAGGAGGTTGGAAGTGGCAGTGCAATTTCTGCAAATTGTACTACAGCGGCTCTTATACTAGAGTTCGTAGTCATTTATTGAAAGAAGGAACAGCGGGGGTGGCAATTTGCACCAAGGTTACTCCTCATGCCTTTACTGCAATGACCAAGTTGGCGAGAGAATCCAAGGAGAGATTAATGAATGCAGCTCCTAGACATGTTCCTCTACCATCATCACAACAGCAAGGAGGGAGTTCCTCTACTAGTAGCTATGGGATGAGTTATCATGCCTATACACAAGCACCAACAGCAAGTGATAGTGGAAAGAAGAGGAAAACAGCTGCTGGTTCTGTTGAAAAGGCCTTCCAAAACTCAGCTAGGGAGCAATGTGATGGTGAGGTTGCAAGGATGTACTACACCGGTGGCTTATCTTTTAACCTAGCTAGAAATCCACACTATCGAAACTCCTACATTCGTGCTTCTACCCTTCCAGGCTATATTCCACCAGGCTACAATGCTCTAAGGACCACACTTCTTGCAAAAGAAAGGAAAAATATTGAGCATCATTTGGAGCCAATCAAGAAAACATGGAAAGATAAAGGTGTGAGTCTTTGTAGTGATGGTTGGTCTGATGCACAAAGAAGACCATTGATTAATGTGATAGCCACTTGTGAGAGTGGTCCAATGATGTTGAAGGCTATAAACTGTCAAGGGGAATTCAAGGATCATGCGATGATTGCAGACTTGATTATAGATTCCATTAAAGAAGTGGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF659

Protein Analysis

301

Amino Acids

32.79

Weight (kDa)

9.44

Isoelectric Point (pI)

38.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF659 PF04937 212 - 301 6.3e-22 Domain of unknown function (DUF659)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000421)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G08267
fragaria_vesca FvH4_2g14331 FvH4_2g16371 FvH4_2g26163 FvH4_3g42540 FvH4_4g02102 FvH4_4g12491 FvH4_4g35171 FvH4_5g06632 FvH4_5g06632 FvH4_5g06632 FvH4_5g08811 FvH4_5g08812 FvH4_5g23531 FvH4_6g10272 FvH4_6g40844 FvH4_7g16803 FvH4_7g16804
malus_domestica MD11G1099500.v1.1 MD17G1176800.v1.1
pyrus_communis pycom05g07840 pycom06g08730 pycom07g12010 pycom07g12020 pycom10g07270 pycom11g17470 pycom12g10610 pycom12g14240 pycom13g22040 pycom15g02440
rosa_chinensis RchiOBHm_Chr1g0371321 RchiOBHm_Chr2g0102701 RchiOBHm_Chr3g0465681 RchiOBHm_Chr4g0420941 RchiOBHm_Chr4g0434271 RchiOBHm_Chr4g0442721 RchiOBHm_Chr6g0262081 RchiOBHm_Chr6g0278171 RchiOBHm_Chr6g0294991 RchiOBHm_Chr6g0295001 RchiOBHm_Chr7g0205361 RchiOBHm_Chr7g0205371 RchiOBHm_Chr7g0223471
rosa_laevigata RLG00000005266
rosa_multiflora Rmu_sc0000493.1_g000033 Rmu_sc0000493.1_g000034 Rmu_sc0000507.1_g000007 Rmu_sc0000843.1_g000001 Rmu_sc0001075.1_g000033 Rmu_sc0002077.1_g000007 Rmu_sc0002077.1_g000008 Rmu_sc0002329.1_g000029 Rmu_sc0002539.1_g000077 Rmu_sc0002655.1_g000006 Rmu_sc0003127.1_g000020 Rmu_sc0003765.1_g000054 Rmu_sc0004368.1_g000023 Rmu_sc0004753.1_g000022 Rmu_sc0005297.1_g000014 Rmu_sc0007633.1_g000010 Rmu_sc0008164.1_g000005 Rmu_sc0008191.1_g000003 Rmu_sc0017900.1_g000005 Rmu_sc0022727.1_g000002
rosa_roxburghii Rroxscaffold_2G00079920 Rroxscaffold_3G00255890 Rroxscaffold_4G00295340 Rroxscaffold_4G00296360 Rroxscaffold_4G00299640 Rroxscaffold_6G00388210
rosa_rugosa Rorug02G0466700 Rorug04G0123200 Rorug05G0074800 Rorug07G0202900
rosa_samantha Rh1DG134700 Rh3CG159000 Rh4AG331000 Rh5AG521100 Rh5BG136400 Rh5DG127300 Rh5DG383100 Rh5DG386100 Rh5DG458000 Rh6CG450400 Rh7CG233800 Rh7DG407100
rosa_wichuraiana Rw1G004960 Rw1G005730 Rw1G006360 Rw1G017400 Rw2G013190 Rw2G022210 Rw2G029640 Rw5G020910 Rw5G036930 Rw6G016200 Rw7G018170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 198, 245
AclWI GGATC 1 cut(s) 861
AcsI RAATTY 2 cut(s) 119, 845
AfaI GTAC 3 cut(s) 58, 191, 542
AflIII ACRYGT 1 cut(s) 346
AgeI ACCGGT 1 cut(s) 548
AgsI TTSAA 5 cut(s) 137, 232, 485, 823, 850
AhlI ACTAGT 2 cut(s) 59, 392
AjnI CCWGG 2 cut(s) 619, 634
AleI CACNNNNGTG 1 cut(s) 112
AluBI AGCT 6 cut(s) 71, 338, 399, 470, 506, 572
AluI AGCT 6 cut(s) 71, 338, 399, 470, 506, 572
AlwI GGATC 1 cut(s) 861
AlwNI CAGNNNCTG 1 cut(s) 473
AoxI GGCC 1 cut(s) 489
ApeKI GCWGC 3 cut(s) 71, 335, 470
ApoI RAATTY 2 cut(s) 119, 845
AseI ATTAAT 2 cut(s) 326, 783
AsiGI ACCGGT 1 cut(s) 548
AspS9I GGNCC 2 cut(s) 654, 809
AsuC2I CCSGG 1 cut(s) 40
AsuHPI GGTGA 1 cut(s) 536
AvaII GGWCC 2 cut(s) 654, 809
BbsI GAAGAC 1 cut(s) 778
BbvI GCAGC 3 cut(s) 58, 347, 457
BccI CCATC 4 cut(s) 2, 367, 515, 743
BceAI ACGGC 1 cut(s) 158
BciT130I CCWGG 2 cut(s) 621, 636
BcnI CCSGG 1 cut(s) 40
BcuI ACTAGT 2 cut(s) 59, 392
BfaI CTAG 8 cut(s) 33, 60, 210, 342, 393, 507, 569, 573
BfmI CTRYAG 1 cut(s) 193
BisI GCNGC 4 cut(s) 72, 199, 336, 471
BlsI GCNGC 4 cut(s) 73, 200, 337, 472
Bme1390I CCNGG 3 cut(s) 40, 621, 636
Bme18I GGWCC 2 cut(s) 654, 809
BmgT120I GGNCC 2 cut(s) 654, 809
BmiI GGNNCC 1 cut(s) 702
BmrFI CCNGG 3 cut(s) 40, 621, 636
BmsI GCATC 3 cut(s) 67, 700, 751
BpiI GAAGAC 1 cut(s) 778
BpuMI CCSGG 1 cut(s) 40
BsaJI CCNNGG 2 cut(s) 264, 315
BsaWI WCCGGW 1 cut(s) 548
Bse118I RCCGGY 2 cut(s) 53, 548
Bse3DI GCAATG 2 cut(s) 297, 521
BseBI CCWGG 2 cut(s) 621, 636
BseDI CCNNGG 2 cut(s) 264, 315
BseGI GGATG 2 cut(s) 411, 543
BseMI GCAATG 2 cut(s) 297, 521
BseMII CTCAG 1 cut(s) 516
BseRI GAGGAG 2 cut(s) 168, 264
BseXI GCAGC 3 cut(s) 58, 347, 457
BshFI GGCC 1 cut(s) 491
BshTI ACCGGT 1 cut(s) 548
BsiSI CCGG 3 cut(s) 39, 54, 549
BsmI GAATGC 1 cut(s) 337
BsnI GGCC 1 cut(s) 491
Bsp143I GATC 2 cut(s) 90, 853
BspACI CCGC 2 cut(s) 198, 245
BspANI GGCC 1 cut(s) 491
BspCNI CTCAG 1 cut(s) 515
BspLI GGNNCC 1 cut(s) 702
BspPI GGATC 1 cut(s) 861
BsrDI GCAATG 2 cut(s) 297, 521
BsrFI RCCGGY 2 cut(s) 53, 548
BssAI RCCGGY 2 cut(s) 53, 548
BssECI CCNNGG 2 cut(s) 264, 315
BssMI GATC 2 cut(s) 90, 853
BssT1I CCWWGG 2 cut(s) 264, 315
Bst2UI CCWGG 2 cut(s) 621, 636
Bst4CI ACNGT 2 cut(s) 111, 836
Bst6I CTCTTC 1 cut(s) 452
BstAPI GCANNNNNTGC 1 cut(s) 180
BstDEI CTNAG 2 cut(s) 502, 650
BstF5I GGATG 2 cut(s) 411, 543
BstKTI GATC 2 cut(s) 93, 856
BstMBI GATC 2 cut(s) 90, 853
BstMWI GCNNNNNNNGC 6 cut(s) 77, 180, 251, 287, 437, 866
BstNI CCWGG 2 cut(s) 621, 636
BstNSI RCATGY 1 cut(s) 350
BstSCI CCNGG 3 cut(s) 38, 619, 634
BstSFI CTRYAG 1 cut(s) 193
BstV1I GCAGC 3 cut(s) 58, 347, 457
BstV2I GAAGAC 1 cut(s) 778
BsuRI GGCC 1 cut(s) 491
BtgZI GCGATG 1 cut(s) 875
BtsCI GGATG 2 cut(s) 411, 543
BtsI GCAGTG 1 cut(s) 176
BtsIMutI CAGTG 1 cut(s) 176
CaiI CAGNNNCTG 1 cut(s) 473
Cfr10I RCCGGY 2 cut(s) 53, 548
Cfr13I GGNCC 2 cut(s) 654, 809
Csp6I GTAC 3 cut(s) 57, 190, 541
CspAI ACCGGT 1 cut(s) 548
CspCI CAANNNNNGTGG 2 cut(s) 646, 681
CviAII CATG 5 cut(s) 278, 347, 416, 717, 857
CviQI GTAC 3 cut(s) 57, 190, 541
DdeI CTNAG 2 cut(s) 502, 650
DpnI GATC 2 cut(s) 92, 855
DpnII GATC 2 cut(s) 90, 853
Eam1104I CTCTTC 1 cut(s) 452
EarI CTCTTC 1 cut(s) 452
Eco130I CCWWGG 2 cut(s) 264, 315
Eco147I AGGCCT 1 cut(s) 491
Eco47I GGWCC 2 cut(s) 654, 809
EcoRI GAATTC 1 cut(s) 845
EcoRII CCWGG 2 cut(s) 619, 634
EcoT14I CCWWGG 2 cut(s) 264, 315
ErhI CCWWGG 2 cut(s) 264, 315
FaeI CATG 5 cut(s) 281, 350, 419, 720, 860
FatI CATG 5 cut(s) 277, 346, 415, 716, 856
FauI CCCGC 1 cut(s) 238
Fnu4HI GCNGC 4 cut(s) 72, 199, 336, 471
FokI GGATG 2 cut(s) 418, 550
Fsp4HI GCNGC 4 cut(s) 72, 199, 336, 471
FspBI CTAG 8 cut(s) 33, 60, 210, 342, 393, 507, 569, 573
GluI GCNGC 4 cut(s) 72, 199, 336, 471
HaeIII GGCC 1 cut(s) 491
HapII CCGG 3 cut(s) 39, 54, 549
Hin1II CATG 5 cut(s) 281, 350, 419, 720, 860
HinfI GANTC 4 cut(s) 133, 311, 736, 884
HpaII CCGG 3 cut(s) 39, 54, 549
HphI GGTGA 1 cut(s) 536
Hpy188I TCNGA 1 cut(s) 760
Hpy188III TCNNGA 1 cut(s) 709
HpyAV CCTTC 4 cut(s) 230, 502, 626, 817
HpyCH4III ACNGT 2 cut(s) 111, 836
HpyCH4V TGCA 9 cut(s) 174, 183, 261, 290, 335, 533, 668, 764, 869
HpyF10VI GCNNNNNNNGC 6 cut(s) 77, 180, 251, 287, 437, 866
HpyF3I CTNAG 2 cut(s) 502, 650
Hsp92II CATG 5 cut(s) 281, 350, 419, 720, 860
Kzo9I GATC 2 cut(s) 90, 853
LmnI GCTCC 4 cut(s) 68, 343, 511, 700
LpnPI CCDG 8 cut(s) 52, 67, 459, 562, 606, 621, 633, 648
Lsp1109I GCAGC 3 cut(s) 58, 347, 457
LweI GCATC 3 cut(s) 67, 700, 751
MaeI CTAG 8 cut(s) 33, 60, 210, 342, 393, 507, 569, 573
MaeIII GTNAC 1 cut(s) 268
MalI GATC 2 cut(s) 92, 855
MboI GATC 2 cut(s) 90, 853
MboII GAAGA 4 cut(s) 139, 142, 469, 783
MluCI AATT 5 cut(s) 119, 175, 185, 255, 845
MlyI GAGTC 1 cut(s) 745
MmeI TCCRAC 1 cut(s) 140
MseI TTAA 5 cut(s) 48, 326, 564, 783, 891
MslI CAYNNNNRTG 1 cut(s) 112
MspA1I CMGCKG 3 cut(s) 198, 245, 470
MspI CCGG 3 cut(s) 39, 54, 549
MspR9I CCNGG 3 cut(s) 40, 621, 636
Mva1269I GAATGC 1 cut(s) 337
MvaI CCWGG 2 cut(s) 621, 636
MwoI GCNNNNNNNGC 6 cut(s) 77, 180, 251, 287, 437, 866
NciI CCSGG 1 cut(s) 40
NdeII GATC 2 cut(s) 90, 853
NlaIII CATG 5 cut(s) 281, 350, 419, 720, 860
NlaIV GGNNCC 1 cut(s) 702
NspI RCATGY 1 cut(s) 350
OliI CACNNNNGTG 1 cut(s) 112
PceI AGGCCT 1 cut(s) 491
PciI ACATGT 1 cut(s) 346
PctI GAATGC 1 cut(s) 337
PfeI GAWTC 3 cut(s) 133, 311, 884
PinAI ACCGGT 1 cut(s) 548
PkrI GCNGC 4 cut(s) 73, 200, 337, 472
PleI GAGTC 1 cut(s) 744
PpsI GAGTC 1 cut(s) 744
PscI ACATGT 1 cut(s) 346
PshBI ATTAAT 2 cut(s) 326, 783
Psp6I CCWGG 2 cut(s) 619, 634
PspGI CCWGG 2 cut(s) 619, 634
PspN4I GGNNCC 1 cut(s) 702
PspPI GGNCC 2 cut(s) 654, 809
PstNI CAGNNNCTG 1 cut(s) 473
PvuII CAGCTG 1 cut(s) 470
RsaI GTAC 3 cut(s) 58, 191, 542
RsaNI GTAC 3 cut(s) 57, 190, 541
RseI CAYNNNNRTG 1 cut(s) 112
SaqAI TTAA 5 cut(s) 48, 326, 564, 783, 891
SatI GCNGC 4 cut(s) 72, 199, 336, 471
Sau3AI GATC 2 cut(s) 90, 853
Sau96I GGNCC 2 cut(s) 654, 809
SchI GAGTC 1 cut(s) 745
ScrFI CCNGG 3 cut(s) 40, 621, 636
SfaNI GCATC 3 cut(s) 67, 700, 751
SfcI CTRYAG 1 cut(s) 193
SgrAI CRCCGGYG 1 cut(s) 548
SinI GGWCC 2 cut(s) 654, 809
SmiMI CAYNNNNRTG 1 cut(s) 112
SpeI ACTAGT 2 cut(s) 59, 392
Sse9I AATT 5 cut(s) 119, 175, 185, 255, 845
SseBI AGGCCT 1 cut(s) 491
SsiI CCGC 2 cut(s) 198, 245
SspI AATATT 1 cut(s) 685
SspMI CTAG 8 cut(s) 33, 60, 210, 342, 393, 507, 569, 573
StuI AGGCCT 1 cut(s) 491
StyD4I CCNGG 3 cut(s) 38, 619, 634
StyI CCWWGG 2 cut(s) 264, 315
TaaI ACNGT 2 cut(s) 111, 836
TaqI TCGA 1 cut(s) 589
TasI AATT 5 cut(s) 119, 175, 185, 255, 845
TatI WGTACW 2 cut(s) 189, 540
TauI GCSGC 1 cut(s) 201
TfiI GAWTC 3 cut(s) 133, 311, 884
Tru1I TTAA 5 cut(s) 48, 326, 564, 783, 891
Tru9I TTAA 5 cut(s) 48, 326, 564, 783, 891
TscAI CASTG 1 cut(s) 176
TseI GCWGC 3 cut(s) 71, 335, 470
TspDTI ATGAA 1 cut(s) 344
TspRI CASTG 1 cut(s) 176
VpaK11BI GGWCC 2 cut(s) 654, 809
VspI ATTAAT 2 cut(s) 326, 783
XapI RAATTY 2 cut(s) 119, 845
XceI RCATGY 1 cut(s) 350
XcmI CCANNNNNNNNNTGG 1 cut(s) 895
XspI CTAG 8 cut(s) 33, 60, 210, 342, 393, 507, 569, 573
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.