Rmu_sc0011173.1_g000003
NAC Family

NAC domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011173.1
Physical Location & Seq
Reverse (-)
5835 .. 7145
1311 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011173.1_g000003.1.cds

Sequence Viewer

Length: 1311 bp
atggatcgttgttttcctgtgggtgtgagattccacccgactgatgaagaactgattgggcactacctccacctcaagaacaatccaaactcggcgacaccgtccttggtactttctgagtttgatttgtacggtgaggccgaaccctggatcatttgggatgcccatggaggacccaatctcaaacaacaagatctcttcttttttactctccttaagaagaaggccaatccccgcggcggccatgctagtacccggcatagtcgaagggttggatcatcgggcacatggagccaaggtgaaccgtccaaacccatttttggcgacaagaaccaggaaaccccaattgggcgaaagacgaaattgaggtacgagaacaaactggtgccggaacaacacggttgttggattatggaggagtataccagtgttgatgatcaatccagttgtcctgccgctcatgatcattatgcgatttgccgactccgagagaacaagactggacaaagaaggaagtctcaggacgatgatgatcaccatccaaagcctaggaaaaagcccaagtctttgacagttgctgatccacaacctgcttttacaaccaatgaggctagaaagacagtgtctttgaaccagagtcctaatcctgagcagcaatttcaaaatgagttgattattagtgacggtgacgcacaaagcagtattggtatgcccgaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggatattgattggcttattggtatgcccgaggatattgattggcttgatcttgcattggaggatattgattggcttgatcttgcattggaggaagtatcccctgcacccgcacaacaacaaacattcacctttcaactttgttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

436

Amino Acids

50.25

Weight (kDa)

4.05

Isoelectric Point (pI)

51.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000371)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g30540 FvH4_5g31040 FvH4_5g34901 FvH4_5g34902 FvH4_5g35290 FvH4_6g26310 FvH4_6g26330 FvH4_6g51360
malus_domestica MD03G1130400.v1.1 MD05G1005400.v1.1 MD05G1030600.v1.1 MD11G1074200.v1.1 MD11G1075500.v1.1 MD11G1075600.v1.1 MD11G1138500.v1.1 MD13G1124900.v1.1 MD15G1393000.v1.1
prunus_persica Prupe.1G063700_v2.0.a1 Prupe.1G106100_v2.0.a1 Prupe.2G196800_v2.0.a1 Prupe.2G202600_v2.0.a1 Prupe.6G057300_v2.0.a1 Prupe.6G092100_v2.0.a1 Prupe.6G098300_v2.0.a1 Prupe.6G098400_v2.0.a1 Prupe.6G112000_v2.0.a1 Prupe.8G095200_v2.0.a1 Prupe.8G097100_v2.0.a1
pyrus_communis pycom03g04400 pycom03g04810 pycom04g03340 pycom11g06160 pycom11g06170 pycom11g06280 pycom12g00070
rosa_chinensis RchiOBHm_Chr2g0126751 RchiOBHm_Chr5g0047081 RchiOBHm_Chr7g0230611 RchiOBHm_Chr7g0236441 RchiOBHm_Chr7g0236481 RchiOBHm_Chr7g0236511
rosa_laevigata RLG00000001105 RLG00000001256 RLG00000018919 RLG00000018920 RLG00000022153
rosa_multiflora Rmu_co8144300.1_g000001 Rmu_sc0000007.1_g000005 Rmu_sc0000007.1_g000006 Rmu_sc0000070.1_g000054 Rmu_sc0000588.1_g000007 Rmu_sc0002222.1_g000014 Rmu_sc0002449.1_g000028 Rmu_sc0003747.1_g000001 Rmu_sc0005733.1_g000007 Rmu_sc0007784.1_g000006 Rmu_sc0011173.1_g000003 Rmu_sc0011236.1_g000004 Rmu_sc0014124.1_g000001
rosa_roxburghii Rroxscaffold_2G00116990 Rroxscaffold_4G00294750 Rroxscaffold_4G00294760 Rroxscaffold_4G00294800
rosa_rugosa Rorug02G0264600 Rorug02G0264600 Rorug02G0564800 Rorug02G0564900
rosa_samantha Rh1AG295700 Rh1AG301300 Rh1BG128600 Rh1BG128700 Rh1BG128800 Rh1CG282300 Rh1DG164800 Rh1DG164900 Rh2AG321700 Rh2AG321800 Rh2AG644400 Rh2AG644500 Rh2BG655200 Rh2BG655300 Rh2CG309500 Rh2CG309600 Rh2CG620500 Rh2DG668700 Rh3BG170600 Rh7AG434800 Rh7BG127300 Rh7BG423300 Rh7BG423700 Rh7BG424100 Rh7BG424200 Rh7CG383900 Rh7CG432200 Rh7CG453500 Rh7DG368300 Rh7DG409100 Rh7DG438400
rosa_wichuraiana Rw0G020640 Rw2G026070 Rw2G026080 Rw5G020070 Rw7G037290 Rw7G037330 Rw7G037540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 598
AccB1I GGYRCC 1 cut(s) 385
AccBSI CCGCTC 1 cut(s) 458
AccI GTMKAC 1 cut(s) 422
AccII CGCG 1 cut(s) 237
AciI CCGC 5 cut(s) 235, 237, 240, 456, 1275
AclWI GGATC 4 cut(s) 12, 158, 283, 575
AcoI YGGCCR 1 cut(s) 241
AfaI GTAC 4 cut(s) 111, 131, 253, 371
AfiI CCNNNNNNNGG 4 cut(s) 147, 239, 320, 348
AflII CTTAAG 1 cut(s) 215
AgsI TTSAA 3 cut(s) 631, 662, 1301
AjnI CCWGG 2 cut(s) 146, 333
AjuI GAANNNNNNNTTGG 4 cut(s) 39, 71, 330, 362
Alw26I GTCTC 1 cut(s) 522
AlwI GGATC 4 cut(s) 12, 158, 283, 575
AlwNI CAGNNNCTG 1 cut(s) 578
Ama87I CYCGRG 2 cut(s) 713, 1193
AoxI GGCC 3 cut(s) 138, 225, 241
ApeKI GCWGC 1 cut(s) 652
ArsI GACNNNNNNTTYG 2 cut(s) 610, 642
AspA2I CCTAGG 1 cut(s) 548
AspS9I GGNCC 1 cut(s) 173
AsuC2I CCSGG 1 cut(s) 256
AsuHPI GGTGA 5 cut(s) 146, 311, 527, 698, 1285
AvaI CYCGRG 2 cut(s) 713, 1193
AvaII GGWCC 1 cut(s) 173
AvrII CCTAGG 1 cut(s) 548
BaeGI GKGCMC 2 cut(s) 63, 287
BanI GGYRCC 1 cut(s) 385
BbvI GCAGC 1 cut(s) 664
BccI CCATC 1 cut(s) 546
BciT130I CCWGG 2 cut(s) 148, 335
BciVI GTATCC 1 cut(s) 1273
BclI TGATCA 3 cut(s) 436, 463, 532
BcnI CCSGG 1 cut(s) 256
BcoDI GTCTC 1 cut(s) 522
BfaI CTAG 3 cut(s) 249, 549, 612
BfrI CTTAAG 1 cut(s) 215
BfuAI ACCTGC 1 cut(s) 598
BfuI GTATCC 1 cut(s) 1273
BglII AGATCT 1 cut(s) 193
BisI GCNGC 4 cut(s) 238, 241, 456, 653
BlnI CCTAGG 1 cut(s) 548
BlsI GCNGC 4 cut(s) 239, 242, 457, 654
Bme1390I CCNGG 3 cut(s) 148, 256, 335
Bme18I GGWCC 1 cut(s) 173
BmeT110I CYCGRG 2 cut(s) 713, 1193
BmgT120I GGNCC 1 cut(s) 173
BmiI GGNNCC 3 cut(s) 175, 293, 387
BmrFI CCNGG 3 cut(s) 148, 256, 335
BmsI GCATC 1 cut(s) 151
Bpu10I CCTNAGC 1 cut(s) 648
BpuEI CTTGAG 1 cut(s) 59
BpuMI CCSGG 1 cut(s) 256
BsaBI GATNNNNATC 2 cut(s) 531, 537
BsaJI CCNNGG 8 cut(s) 105, 146, 166, 235, 295, 548, 714, 1194
BsaXI ACNNNNNCTCC 2 cut(s) 283, 313
Bsc4I CCNNNNNNNGG 4 cut(s) 147, 239, 320, 348
Bse1I ACTGG 4 cut(s) 387, 426, 444, 505
Bse8I GATNNNNATC 2 cut(s) 531, 537
BseBI CCWGG 2 cut(s) 148, 335
BseDI CCNNGG 8 cut(s) 105, 146, 166, 235, 295, 548, 714, 1194
BseGI GGATG 2 cut(s) 166, 538
BseJI GATNNNNATC 2 cut(s) 531, 537
BseLI CCNNNNNNNGG 4 cut(s) 147, 239, 320, 348
BseMII CTCAG 3 cut(s) 108, 533, 639
BseNI ACTGG 4 cut(s) 387, 426, 444, 505
BseRI GAGGAG 1 cut(s) 431
BseSI GKGCMC 2 cut(s) 63, 287
BseXI GCAGC 1 cut(s) 664
BsgI GTGCAG 1 cut(s) 1254
Bsh1236I CGCG 1 cut(s) 237
BshFI GGCC 3 cut(s) 140, 227, 243
BshNI GGYRCC 1 cut(s) 385
BsiHKCI CYCGRG 2 cut(s) 713, 1193
BsiSI CCGG 2 cut(s) 256, 389
BslI CCNNNNNNNGG 4 cut(s) 147, 239, 320, 348
BsmAI GTCTC 1 cut(s) 522
BsnI GGCC 3 cut(s) 140, 227, 243
BsoBI CYCGRG 2 cut(s) 713, 1193
Bsp1286I GDGCHC 2 cut(s) 63, 287
Bsp19I CCATGG 1 cut(s) 166
BspACI CCGC 5 cut(s) 235, 237, 240, 456, 1275
BspANI GGCC 3 cut(s) 140, 227, 243
BspCNI CTCAG 3 cut(s) 109, 532, 640
BspFNI CGCG 1 cut(s) 237
BspHI TCATGA 1 cut(s) 460
BspLI GGNNCC 3 cut(s) 175, 293, 387
BspMI ACCTGC 1 cut(s) 598
BspPI GGATC 4 cut(s) 12, 158, 283, 575
BspT107I GGYRCC 1 cut(s) 385
BspTI CTTAAG 1 cut(s) 215
BsrBI CCGCTC 1 cut(s) 458
BsrI ACTGG 4 cut(s) 387, 426, 444, 505
BssECI CCNNGG 8 cut(s) 105, 146, 166, 235, 295, 548, 714, 1194
BssNAI GTATAC 1 cut(s) 423
BssT1I CCWWGG 4 cut(s) 105, 166, 295, 548
Bst1107I GTATAC 1 cut(s) 423
Bst2UI CCWGG 2 cut(s) 148, 335
Bst4CI ACNGT 7 cut(s) 102, 134, 306, 401, 574, 622, 686
Bst6I CTCTTC 1 cut(s) 203
BstAFI CTTAAG 1 cut(s) 215
BstDEI CTNAG 3 cut(s) 117, 519, 648
BstDSI CCRYGG 2 cut(s) 166, 235
BstF5I GGATG 2 cut(s) 166, 538
BstFNI CGCG 1 cut(s) 237
BstMAI GTCTC 1 cut(s) 522
BstMWI GCNNNNNNNGC 1 cut(s) 291
BstNI CCWGG 2 cut(s) 148, 335
BstSCI CCNGG 3 cut(s) 146, 254, 333
BstSLI GKGCMC 2 cut(s) 63, 287
BstUI CGCG 1 cut(s) 237
BstV1I GCAGC 1 cut(s) 664
BstX2I RGATCY 1 cut(s) 193
BstYI RGATCY 1 cut(s) 193
BstZ17I GTATAC 1 cut(s) 423
BsuI GTATCC 1 cut(s) 1273
BsuRI GGCC 3 cut(s) 140, 227, 243
BtgI CCRYGG 2 cut(s) 166, 235
BtsCI GGATG 2 cut(s) 166, 538
BtsIMutI CAGTG 2 cut(s) 433, 627
BveI ACCTGC 1 cut(s) 598
CaiI CAGNNNCTG 1 cut(s) 578
CciI TCATGA 1 cut(s) 460
Cfr13I GGNCC 1 cut(s) 173
Cfr42I CCGCGG 1 cut(s) 238
CseI GACGC 1 cut(s) 698
Csp6I GTAC 4 cut(s) 110, 130, 252, 370
CviAII CATG 4 cut(s) 167, 245, 288, 461
CviQI GTAC 4 cut(s) 110, 130, 252, 370
DdeI CTNAG 3 cut(s) 117, 519, 648
EaeI YGGCCR 1 cut(s) 241
Eam1104I CTCTTC 1 cut(s) 203
EarI CTCTTC 1 cut(s) 203
Eco130I CCWWGG 4 cut(s) 105, 166, 295, 548
Eco47I GGWCC 1 cut(s) 173
Eco88I CYCGRG 2 cut(s) 713, 1193
EcoO109I RGGNCCY 1 cut(s) 173
EcoRII CCWGG 2 cut(s) 146, 333
EcoT14I CCWWGG 4 cut(s) 105, 166, 295, 548
ErhI CCWWGG 4 cut(s) 105, 166, 295, 548
FaeI CATG 4 cut(s) 170, 248, 291, 464
FatI CATG 4 cut(s) 166, 244, 287, 460
FauI CCCGC 2 cut(s) 242, 1282
FbaI TGATCA 3 cut(s) 436, 463, 532
FblI GTMKAC 1 cut(s) 422
Fnu4HI GCNGC 4 cut(s) 238, 241, 456, 653
FokI GGATG 2 cut(s) 173, 525
Fsp4HI GCNGC 4 cut(s) 238, 241, 456, 653
FspBI CTAG 3 cut(s) 249, 549, 612
GluI GCNGC 4 cut(s) 238, 241, 456, 653
HaeIII GGCC 3 cut(s) 140, 227, 243
HapII CCGG 2 cut(s) 256, 389
HgaI GACGC 1 cut(s) 698
Hin1II CATG 4 cut(s) 170, 248, 291, 464
HinfI GANTC 3 cut(s) 30, 483, 637
HpaII CCGG 2 cut(s) 256, 389
HphI GGTGA 5 cut(s) 146, 311, 527, 698, 1285
Hpy166II GTNNAC 2 cut(s) 302, 423
Hpy188I TCNGA 2 cut(s) 118, 488
Hpy188III TCNNGA 4 cut(s) 76, 461, 521, 647
Hpy8I GTNNAC 2 cut(s) 302, 423
HpyAV CCTTC 3 cut(s) 217, 261, 504
HpyCH4III ACNGT 7 cut(s) 102, 134, 306, 401, 574, 622, 686
HpyF10VI GCNNNNNNNGC 1 cut(s) 291
HpyF3I CTNAG 3 cut(s) 117, 519, 648
Hsp92II CATG 4 cut(s) 170, 248, 291, 464
Ksp22I TGATCA 3 cut(s) 436, 463, 532
KspI CCGCGG 1 cut(s) 238
LmnI GCTCC 1 cut(s) 291
Lsp1109I GCAGC 1 cut(s) 664
LweI GCATC 1 cut(s) 151
MaeI CTAG 3 cut(s) 249, 549, 612
MaeIII GTNAC 2 cut(s) 680, 686
MbiI CCGCTC 1 cut(s) 458
MboII GAAGA 3 cut(s) 59, 190, 232
MfeI CAATTG 1 cut(s) 345
MflI RGATCY 1 cut(s) 193
MhlI GDGCHC 2 cut(s) 63, 287
MluCI AATT 3 cut(s) 345, 362, 656
MlyI GAGTC 2 cut(s) 477, 646
MmeI TCCRAC 2 cut(s) 253, 386
MseI TTAA 2 cut(s) 216, 1309
MspA1I CMGCKG 1 cut(s) 237
MspCI CTTAAG 1 cut(s) 215
MspI CCGG 2 cut(s) 256, 389
MspR9I CCNGG 3 cut(s) 148, 256, 335
MunI CAATTG 1 cut(s) 345
MvaI CCWGG 2 cut(s) 148, 335
MvnI CGCG 1 cut(s) 237
MwoI GCNNNNNNNGC 1 cut(s) 291
NciI CCSGG 1 cut(s) 256
NcoI CCATGG 1 cut(s) 166
NlaIII CATG 4 cut(s) 170, 248, 291, 464
NlaIV GGNNCC 3 cut(s) 175, 293, 387
NmeAIII GCCGAG 1 cut(s) 71
NmuCI GTSAC 2 cut(s) 680, 686
PagI TCATGA 1 cut(s) 460
PcsI WCGNNNNNNNCGW 2 cut(s) 98, 138
PfeI GAWTC 1 cut(s) 30
PflFI GACNNNGTC 2 cut(s) 100, 622
PkrI GCNGC 4 cut(s) 239, 242, 457, 654
PleI GAGTC 2 cut(s) 477, 645
PpsI GAGTC 2 cut(s) 477, 645
PpuMI RGGWCCY 1 cut(s) 173
Psp5II RGGWCCY 1 cut(s) 173
Psp6I CCWGG 2 cut(s) 146, 333
PspGI CCWGG 2 cut(s) 146, 333
PspN4I GGNNCC 3 cut(s) 175, 293, 387
PspPI GGNCC 1 cut(s) 173
PspPPI RGGWCCY 1 cut(s) 173
PstNI CAGNNNCTG 1 cut(s) 578
PsuI RGATCY 1 cut(s) 193
PsyI GACNNNGTC 2 cut(s) 100, 622
RsaI GTAC 4 cut(s) 111, 131, 253, 371
RsaNI GTAC 4 cut(s) 110, 130, 252, 370
SacII CCGCGG 1 cut(s) 238
SaqAI TTAA 2 cut(s) 216, 1309
SatI GCNGC 4 cut(s) 238, 241, 456, 653
Sau96I GGNCC 1 cut(s) 173
SchI GAGTC 2 cut(s) 477, 646
ScrFI CCNGG 3 cut(s) 148, 256, 335
SduI GDGCHC 2 cut(s) 63, 287
SetI ASST 6 cut(s) 69, 75, 301, 371, 592, 1298
SfaNI GCATC 1 cut(s) 151
Sfr303I CCGCGG 1 cut(s) 238
SgrBI CCGCGG 1 cut(s) 238
SinI GGWCC 1 cut(s) 173
SmlI CTYRAG 2 cut(s) 74, 215
SmoI CTYRAG 2 cut(s) 74, 215
Sse9I AATT 3 cut(s) 345, 362, 656
SsiI CCGC 5 cut(s) 235, 237, 240, 456, 1275
SspMI CTAG 3 cut(s) 249, 549, 612
StyD4I CCNGG 3 cut(s) 146, 254, 333
StyI CCWWGG 4 cut(s) 105, 166, 295, 548
TaaI ACNGT 7 cut(s) 102, 134, 306, 401, 574, 622, 686
TaqI TCGA 1 cut(s) 265
TasI AATT 3 cut(s) 345, 362, 656
TauI GCSGC 3 cut(s) 240, 243, 458
TfiI GAWTC 1 cut(s) 30
Tru1I TTAA 2 cut(s) 216, 1309
Tru9I TTAA 2 cut(s) 216, 1309
TscAI CASTG 2 cut(s) 433, 627
TseFI GTSAC 2 cut(s) 680, 686
TseI GCWGC 1 cut(s) 652
Tsp45I GTSAC 2 cut(s) 680, 686
TspDTI ATGAA 1 cut(s) 60
TspRI CASTG 2 cut(s) 433, 627
Tth111I GACNNNGTC 2 cut(s) 100, 622
Vha464I CTTAAG 1 cut(s) 215
VpaK11BI GGWCC 1 cut(s) 173
XmaJI CCTAGG 1 cut(s) 548
XmiI GTMKAC 1 cut(s) 422
XspI CTAG 3 cut(s) 249, 549, 612
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.