Rh2DG668700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0000371
Physical Location & Seq
Forward (+)
89254327 .. 89254632
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG668700.1

Sequence Viewer

Length: 306 bp
ATGATCCCATCAAGATCGATAGGGATTAAGTGCATTAAGCCGAGGAACAAGAGGTTAAGAAGAGTGGATCATCAAGAAGTGATGGAAAATACTTTGATGAGTATGCCCAGCAATAACAAAGATCATCCATCAACATCAACAGAGATGAATATGCCCAGCAACAACTACTACTTTAAAAATGAGGAGGATTTACCACAAAGTTCAACTAAACATGACCAGCAATTCAGTATTAGTGAAAACTTGGATTTCGTTGCGGATCATGTTCATACTAATCTCATGCCAATCAATAATGTGAGGAGGATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.85

Weight (kDa)

7.96

Isoelectric Point (pI)

74.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000371)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g30540 FvH4_5g31040 FvH4_5g34901 FvH4_5g34902 FvH4_5g35290 FvH4_6g26310 FvH4_6g26330 FvH4_6g51360
malus_domestica MD03G1130400.v1.1 MD05G1005400.v1.1 MD05G1030600.v1.1 MD11G1074200.v1.1 MD11G1075500.v1.1 MD11G1075600.v1.1 MD11G1138500.v1.1 MD13G1124900.v1.1 MD15G1393000.v1.1
prunus_persica Prupe.1G063700_v2.0.a1 Prupe.1G106100_v2.0.a1 Prupe.2G196800_v2.0.a1 Prupe.2G202600_v2.0.a1 Prupe.6G057300_v2.0.a1 Prupe.6G092100_v2.0.a1 Prupe.6G098300_v2.0.a1 Prupe.6G098400_v2.0.a1 Prupe.6G112000_v2.0.a1 Prupe.8G095200_v2.0.a1 Prupe.8G097100_v2.0.a1
pyrus_communis pycom03g04400 pycom03g04810 pycom04g03340 pycom11g06160 pycom11g06170 pycom11g06280 pycom12g00070
rosa_chinensis RchiOBHm_Chr2g0126751 RchiOBHm_Chr5g0047081 RchiOBHm_Chr7g0230611 RchiOBHm_Chr7g0236441 RchiOBHm_Chr7g0236481 RchiOBHm_Chr7g0236511
rosa_laevigata RLG00000001105 RLG00000001256 RLG00000018919 RLG00000018920 RLG00000022153
rosa_multiflora Rmu_co8144300.1_g000001 Rmu_sc0000007.1_g000005 Rmu_sc0000007.1_g000006 Rmu_sc0000070.1_g000054 Rmu_sc0000588.1_g000007 Rmu_sc0002222.1_g000014 Rmu_sc0002449.1_g000028 Rmu_sc0003747.1_g000001 Rmu_sc0005733.1_g000007 Rmu_sc0007784.1_g000006 Rmu_sc0011173.1_g000003 Rmu_sc0011236.1_g000004 Rmu_sc0014124.1_g000001
rosa_roxburghii Rroxscaffold_2G00116990 Rroxscaffold_4G00294750 Rroxscaffold_4G00294760 Rroxscaffold_4G00294800
rosa_rugosa Rorug02G0264600 Rorug02G0264600 Rorug02G0564800 Rorug02G0564900
rosa_samantha Rh1AG295700 Rh1AG301300 Rh1BG128600 Rh1BG128700 Rh1BG128800 Rh1CG282300 Rh1DG164800 Rh1DG164900 Rh2AG321700 Rh2AG321800 Rh2AG644400 Rh2AG644500 Rh2BG655200 Rh2BG655300 Rh2CG309500 Rh2CG309600 Rh2CG620500 Rh2DG668700 Rh3BG170600 Rh7AG434800 Rh7BG127300 Rh7BG423300 Rh7BG423700 Rh7BG424100 Rh7BG424200 Rh7CG383900 Rh7CG432200 Rh7CG453500 Rh7DG368300 Rh7DG409100 Rh7DG438400
rosa_wichuraiana Rw0G020640 Rw2G026070 Rw2G026080 Rw5G020070 Rw7G037290 Rw7G037330 Rw7G037540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 254
AclWI GGATC 2 cut(s) 75, 264
AgsI TTSAA 1 cut(s) 204
AlwI GGATC 2 cut(s) 75, 264
BccI CCATC 3 cut(s) 16, 76, 136
Bsa29I ATCGAT 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 41
BseCI ATCGAT 1 cut(s) 17
BseDI CCNNGG 1 cut(s) 41
BseGI GGATG 2 cut(s) 124, 306
BseRI GAGGAG 1 cut(s) 197
BseYI CCCAGC 2 cut(s) 107, 155
BshVI ATCGAT 1 cut(s) 17
Bsp143I GATC 5 cut(s) 3, 14, 67, 121, 256
BspACI CCGC 1 cut(s) 254
BspDI ATCGAT 1 cut(s) 17
BspPI GGATC 2 cut(s) 75, 264
BssECI CCNNGG 1 cut(s) 41
BssMI GATC 5 cut(s) 3, 14, 67, 121, 256
Bst6I CTCTTC 1 cut(s) 55
BstF5I GGATG 2 cut(s) 124, 306
BstKTI GATC 5 cut(s) 6, 17, 70, 124, 259
BstMBI GATC 5 cut(s) 3, 14, 67, 121, 256
Bsu15I ATCGAT 1 cut(s) 17
BsuTUI ATCGAT 1 cut(s) 17
BtsCI GGATG 2 cut(s) 124, 306
ClaI ATCGAT 1 cut(s) 17
CviAII CATG 3 cut(s) 212, 260, 277
CviJI RGCY 1 cut(s) 40
CviKI_1 RGCY 1 cut(s) 40
DpnI GATC 5 cut(s) 5, 16, 69, 123, 258
DpnII GATC 5 cut(s) 3, 14, 67, 121, 256
DraI TTTAAA 1 cut(s) 175
Eam1104I CTCTTC 1 cut(s) 55
EarI CTCTTC 1 cut(s) 55
FaeI CATG 3 cut(s) 215, 263, 280
FaiI YATR 6 cut(s) 104, 152, 213, 261, 267, 278
FatI CATG 3 cut(s) 211, 259, 276
FokI GGATG 1 cut(s) 111
GsaI CCCAGC 2 cut(s) 111, 159
Hin1II CATG 3 cut(s) 215, 263, 280
Hpy188III TCNNGA 2 cut(s) 12, 74
HpyCH4V TGCA 1 cut(s) 33
Hsp92II CATG 3 cut(s) 215, 263, 280
Kzo9I GATC 5 cut(s) 3, 14, 67, 121, 256
LpnPI CCDG 3 cut(s) 121, 169, 230
MalI GATC 5 cut(s) 5, 16, 69, 123, 258
MboI GATC 5 cut(s) 3, 14, 67, 121, 256
MboII GAAGA 1 cut(s) 72
MluCI AATT 1 cut(s) 221
MnlI CCTC 6 cut(s) 36, 45, 175, 178, 288, 291
MseI TTAA 4 cut(s) 27, 36, 56, 174
NdeII GATC 5 cut(s) 3, 14, 67, 121, 256
NlaIII CATG 3 cut(s) 215, 263, 280
NmeAIII GCCGAG 1 cut(s) 66
PspFI CCCAGC 2 cut(s) 107, 155
SaqAI TTAA 4 cut(s) 27, 36, 56, 174
Sau3AI GATC 5 cut(s) 3, 14, 67, 121, 256
SetI ASST 1 cut(s) 56
Sse9I AATT 1 cut(s) 221
SsiI CCGC 1 cut(s) 254
TaqI TCGA 1 cut(s) 17
TasI AATT 1 cut(s) 221
Tru1I TTAA 4 cut(s) 27, 36, 56, 174
Tru9I TTAA 4 cut(s) 27, 36, 56, 174
TspDTI ATGAA 2 cut(s) 161, 254
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.