Rh6AG421900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0000278
Physical Location & Seq
Reverse (-)
61519851 .. 61520577
727 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG421900.1

Sequence Viewer

Length: 180 bp
ATGGAGGACCATATTAAGGAGTTCAACAAGATGTTGAAGGAACTGTCTGACGCGAAGGTGAGGATCAAGGAGGAAGACAAGGTTGCAGTTCTTCTTGCCTCACTACCTGAGAATTTTGATCCTTCTTTGGAGTCCATGCTAGATGAGGATGGTGCGGTAAATCGAAATGTCAAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.76

Weight (kDa)

4.86

Isoelectric Point (pI)

45.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_2 PF14223 1 - 48 1.4e-08 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000278)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G29785
fragaria_vesca FvH4_1g10046 FvH4_1g17351 FvH4_1g18441 FvH4_1g24222 FvH4_2g00141 FvH4_2g05931 FvH4_2g06671 FvH4_2g14030 FvH4_2g15291 FvH4_2g22611 FvH4_2g22612 FvH4_2g26380 FvH4_2g39202 FvH4_2g39202 FvH4_3g06691 FvH4_3g08580 FvH4_3g20502 FvH4_3g20503 FvH4_3g22421 FvH4_3g42580 FvH4_4g02061 FvH4_4g06794 FvH4_4g08661 FvH4_4g11771 FvH4_4g14601 FvH4_4g14721 FvH4_4g20921 FvH4_4g33601 FvH4_4g33602 FvH4_5g07492 FvH4_5g20321 FvH4_5g21591 FvH4_5g30343 FvH4_5g37875 FvH4_6g04372 FvH4_6g04373 FvH4_6g04373 FvH4_6g21377 FvH4_6g23760 FvH4_6g29471 FvH4_6g43142 FvH4_7g14351 FvH4_7g14352 FvH4_7g22582 FvH4_7g22583 FvH4_7g22584
malus_domestica MD00G1179400.v1.1 MD01G1170500.v1.1 MD03G1286700.v1.1 MD04G1054600.v1.1 MD04G1071700.v1.1 MD04G1193900.v1.1 MD08G1054300.v1.1 MD08G1217500.v1.1 MD09G1034600.v1.1 MD09G1098100.v1.1 MD10G1018300.v1.1 MD10G1220000.v1.1 MD10G1250300.v1.1 MD12G1014400.v1.1 MD15G1021000.v1.1 MD16G1112200.v1.1
prunus_persica Prupe.1G188900_v2.0.a1 Prupe.1G258000_v2.0.a1 Prupe.4G233400_v2.0.a1
pyrus_communis pycom01g10100 pycom02g01340 pycom03g19700 pycom05g01320 pycom07g16000 pycom07g16520 pycom11g26500 pycom13g09380 pycom13g13960 pycom14g08180 pycom14g16810 pycom16g09590
rosa_chinensis RchiOBHm_Chr1g0319891 RchiOBHm_Chr1g0333711 RchiOBHm_Chr2g0115331 RchiOBHm_Chr2g0143411 RchiOBHm_Chr2g0167631 RchiOBHm_Chr3g0448581 RchiOBHm_Chr3g0494991 RchiOBHm_Chr4g0442471 RchiOBHm_Chr6g0262311 RchiOBHm_Chr6g0301831 RchiOBHm_Chr6g0301841 RchiOBHm_Chr7g0183451
rosa_roxburghii Rroxscaffold_1G00039280 Rroxscaffold_1G00047670 Rroxscaffold_1G00066330 Rroxscaffold_2G00107510 Rroxscaffold_3G00255410 Rroxscaffold_4G00301460 Rroxscaffold_5G00352730 Rroxscaffold_7G00166350 Rroxscaffold_7G00166360 Rroxscaffold_7G00203820
rosa_rugosa Rorug03G0240500 Rorug05G0191700 Rorug06G0310200
rosa_samantha Rh2BG287000 Rh4CG073500 Rh4CG176200 Rh4CG191400 Rh5BG356100 Rh5BG434100 Rh6AG110600 Rh6AG421900 Rh6AG422000 Rh6AG422100 Rh6BG428600 Rh6BG428700 Rh6BG428800 Rh6CG435200 Rh6CG435300 Rh6CG435400 Rh6DG422000 Rh6DG422100 Rh6DG422200 Rh7BG190500 Rh7CG172800 Rh7CG225200
rosa_wichuraiana Rw2G044060 Rw6G036540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 53
AciI CCGC 1 cut(s) 155
AclWI GGATC 2 cut(s) 71, 113
AcsI RAATTY 1 cut(s) 112
AfiI CCNNNNNNNGG 1 cut(s) 16
AgsI TTSAA 2 cut(s) 25, 37
AlwI GGATC 2 cut(s) 71, 113
ApoI RAATTY 1 cut(s) 112
AspS9I GGNCC 1 cut(s) 7
AsuHPI GGTGA 1 cut(s) 70
AvaII GGWCC 1 cut(s) 7
BbsI GAAGAC 1 cut(s) 81
BccI CCATC 1 cut(s) 143
BfaI CTAG 1 cut(s) 140
Bme18I GGWCC 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 7
BpiI GAAGAC 1 cut(s) 81
Bsc4I CCNNNNNNNGG 1 cut(s) 16
BseGI GGATG 1 cut(s) 154
BseLI CCNNNNNNNGG 1 cut(s) 16
BseMII CTCAG 1 cut(s) 99
Bsh1236I CGCG 1 cut(s) 53
BslI CCNNNNNNNGG 1 cut(s) 16
Bsp143I GATC 2 cut(s) 63, 118
BspACI CCGC 1 cut(s) 155
BspCNI CTCAG 1 cut(s) 100
BspFNI CGCG 1 cut(s) 53
BspPI GGATC 2 cut(s) 71, 113
BssMI GATC 2 cut(s) 63, 118
Bst4CI ACNGT 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 108
BstF5I GGATG 1 cut(s) 154
BstFNI CGCG 1 cut(s) 53
BstKTI GATC 2 cut(s) 66, 121
BstMBI GATC 2 cut(s) 63, 118
BstUI CGCG 1 cut(s) 53
BstV2I GAAGAC 1 cut(s) 81
BtsCI GGATG 1 cut(s) 154
Cfr13I GGNCC 1 cut(s) 7
CseI GACGC 1 cut(s) 59
CviAII CATG 1 cut(s) 136
DdeI CTNAG 1 cut(s) 108
DpnI GATC 2 cut(s) 65, 120
DpnII GATC 2 cut(s) 63, 118
Eco47I GGWCC 1 cut(s) 7
FaeI CATG 1 cut(s) 139
FaiI YATR 2 cut(s) 12, 137
FatI CATG 1 cut(s) 135
FokI GGATG 1 cut(s) 161
FspBI CTAG 1 cut(s) 140
HgaI GACGC 1 cut(s) 59
Hin1II CATG 1 cut(s) 139
HinfI GANTC 1 cut(s) 131
HphI GGTGA 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 49
Hpy188III TCNNGA 1 cut(s) 172
HpyAV CCTTC 3 cut(s) 31, 49, 132
HpyCH4III ACNGT 1 cut(s) 45
HpyCH4V TGCA 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 108
Hsp92II CATG 1 cut(s) 139
Kzo9I GATC 2 cut(s) 63, 118
LpnPI CCDG 1 cut(s) 120
MaeI CTAG 1 cut(s) 140
MalI GATC 2 cut(s) 65, 120
MboI GATC 2 cut(s) 63, 118
MboII GAAGA 2 cut(s) 83, 86
MluCI AATT 1 cut(s) 112
MlyI GAGTC 1 cut(s) 140
MnlI CCTC 4 cut(s) 54, 64, 109, 139
MseI TTAA 1 cut(s) 15
MvnI CGCG 1 cut(s) 53
NdeII GATC 2 cut(s) 63, 118
NlaIII CATG 1 cut(s) 139
PleI GAGTC 1 cut(s) 139
PpsI GAGTC 1 cut(s) 139
PspPI GGNCC 1 cut(s) 7
SaqAI TTAA 1 cut(s) 15
Sau3AI GATC 2 cut(s) 63, 118
Sau96I GGNCC 1 cut(s) 7
SchI GAGTC 1 cut(s) 140
SetI ASST 3 cut(s) 60, 84, 109
SgeI CNNG 8 cut(s) 40, 64, 79, 91, 107, 119, 148, 152
SinI GGWCC 1 cut(s) 7
Sse9I AATT 1 cut(s) 112
SsiI CCGC 1 cut(s) 155
SspMI CTAG 1 cut(s) 140
TaaI ACNGT 1 cut(s) 45
TaqI TCGA 1 cut(s) 163
TasI AATT 1 cut(s) 112
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
VpaK11BI GGWCC 1 cut(s) 7
XapI RAATTY 1 cut(s) 112
XspI CTAG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.