Rh6DG062600

source UniProtKB

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0000290
Physical Location & Seq
Forward (+)
6401189 .. 6402086
898 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG062600.1

Sequence Viewer

Length: 222 bp
ATGTTGGCGCGGACTAAGGTGCCCATCAACATTGTAAGCTGGCCCGACGTGGACGGTGACTTGAAGGATAAACTTTGGCTCGATGTTAAGAAAAAGACTTTGCCTGAAGGAGAGATAATAGATCGTGCAATTATGTGGAAGAAAGCCCGTGAACGTAAAGATGGGGACATAGATGAAGAGGCTAGAGCTGTGGTGACAAAGATAGTAAGTATTGTTAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4216 DUF4218 Transpos_assoc Transposase_21

Protein Analysis

73

Amino Acids

8.37

Weight (kDa)

7.99

Isoelectric Point (pI)

19.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000290)

Species Orthologous Gene IDs
prunus_persica Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1 Prupe.7G026800_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0352291 RchiOBHm_Chr1g0352301 RchiOBHm_Chr2g0145261 RchiOBHm_Chr2g0160781 RchiOBHm_Chr2g0160871 RchiOBHm_Chr3g0460901 RchiOBHm_Chr3g0494431 RchiOBHm_Chr3g0494441 RchiOBHm_Chr4g0385451 RchiOBHm_Chr4g0417051 RchiOBHm_Chr4g0424111 RchiOBHm_Chr5g0035911 RchiOBHm_Chr6g0269251 RchiOBHm_Chr6g0274141 RchiOBHm_Chr7g0191841 RchiOBHm_Chr7g0196691 RchiOBHm_Chr7g0211271 RchiOBHm_Chr7g0227321 RchiOBHm_Chr7g0242811
rosa_laevigata RLG00000013212
rosa_multiflora Rmu_co8387591.1_g000001 Rmu_sc0000147.1_g000094 Rmu_sc0000340.1_g000034 Rmu_sc0000546.1_g000048 Rmu_sc0001461.1_g000092 Rmu_sc0001659.1_g000042 Rmu_sc0002460.1_g000027 Rmu_sc0003170.1_g000021 Rmu_sc0004301.1_g000015 Rmu_sc0004344.1_g000009 Rmu_sc0005539.1_g000024 Rmu_sc0006803.1_g000018 Rmu_sc0006888.1_g000057 Rmu_sc0009330.1_g000004 Rmu_sc0010704.1_g000001 Rmu_sc0012787.1_g000002 Rmu_sc0023684.1_g000002 Rmu_ssc0000189.1_g000010
rosa_roxburghii Rroxscaffold_5G00377480 Rroxscaffold_6G00389290 Rroxscaffold_6G00414410 Rroxscaffold_7G00202010
rosa_rugosa Rorug01G0242100 Rorug02G0188500 Rorug02G0273900 Rorug03G0342600 Rorug05G0239000 Rorug07G0163300 Rorug07G0192100
rosa_samantha Rh1BG091000 Rh1BG200300 Rh1DG228100 Rh2AG268900 Rh2AG431600 Rh2AG508400 Rh2CG258700 Rh2CG417500 Rh2CG493900 Rh3AG323800 Rh3BG237800 Rh3CG306700 Rh3DG204700 Rh3DG259400 Rh4AG203100 Rh4AG377200 Rh4BG054300 Rh4BG125100 Rh4BG146000 Rh4BG251900 Rh4DG132500 Rh4DG155000 Rh4DG384000 Rh5BG230700 Rh5CG382700 Rh5CG532300 Rh5DG235600 Rh5DG259700 Rh5DG320000 Rh6AG162900 Rh6CG065400 Rh6CG065500 Rh6CG307600 Rh6CG310500 Rh6CG391900 Rh6DG062500 Rh6DG062600 Rh6DG187500 Rh7BG296200 Rh7DG266900 Rh7DG322300
rosa_wichuraiana Rw2G018510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 19
AccII CGCG 1 cut(s) 10
AciI CCGC 1 cut(s) 10
AcuI CTGAAG 1 cut(s) 126
AgsI TTSAA 1 cut(s) 64
AjiI CACGTC 1 cut(s) 49
AluBI AGCT 2 cut(s) 39, 188
AluI AGCT 2 cut(s) 39, 188
AoxI GGCC 1 cut(s) 41
AspLEI GCGC 1 cut(s) 10
AspS9I GGNCC 1 cut(s) 42
AsuHPI GGTGA 2 cut(s) 68, 205
BaeGI GKGCMC 1 cut(s) 24
BanI GGYRCC 1 cut(s) 19
BccI CCATC 2 cut(s) 32, 155
BfaI CTAG 2 cut(s) 183, 220
BmgBI CACGTC 1 cut(s) 49
BmgT120I GGNCC 1 cut(s) 42
BmiI GGNNCC 1 cut(s) 21
BseSI GKGCMC 1 cut(s) 24
Bsh1236I CGCG 1 cut(s) 10
BshFI GGCC 1 cut(s) 43
BshNI GGYRCC 1 cut(s) 19
BslFI GGGAC 1 cut(s) 179
BsmFI GGGAC 1 cut(s) 179
BsnI GGCC 1 cut(s) 43
Bsp1286I GDGCHC 1 cut(s) 24
Bsp143I GATC 1 cut(s) 121
BspACI CCGC 1 cut(s) 10
BspANI GGCC 1 cut(s) 43
BspFNI CGCG 1 cut(s) 10
BspLI GGNNCC 1 cut(s) 21
BspT107I GGYRCC 1 cut(s) 19
BssMI GATC 1 cut(s) 121
Bst4CI ACNGT 1 cut(s) 56
Bst6I CTCTTC 1 cut(s) 171
BstC8I GCNNGC 1 cut(s) 41
BstDEI CTNAG 1 cut(s) 15
BstFNI CGCG 1 cut(s) 10
BstHHI GCGC 1 cut(s) 10
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstSLI GKGCMC 1 cut(s) 24
BstUI CGCG 1 cut(s) 10
BsuRI GGCC 1 cut(s) 43
BtrI CACGTC 1 cut(s) 49
Cac8I GCNNGC 1 cut(s) 41
CfoI GCGC 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 42
CviJI RGCY 6 cut(s) 39, 43, 79, 146, 182, 188
CviKI_1 RGCY 6 cut(s) 39, 43, 79, 146, 182, 188
DdeI CTNAG 1 cut(s) 15
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
Eam1104I CTCTTC 1 cut(s) 171
EarI CTCTTC 1 cut(s) 171
Eco57I CTGAAG 1 cut(s) 126
FaiI YATR 2 cut(s) 134, 170
FaqI GGGAC 1 cut(s) 179
FspBI CTAG 2 cut(s) 183, 220
GlaI GCGC 1 cut(s) 9
HaeIII GGCC 1 cut(s) 43
HhaI GCGC 1 cut(s) 10
Hin6I GCGC 1 cut(s) 8
HinP1I GCGC 1 cut(s) 8
HincII GTYRAC 1 cut(s) 217
HindII GTYRAC 1 cut(s) 217
HpaI GTTAAC 1 cut(s) 217
HphI GGTGA 2 cut(s) 68, 205
Hpy166II GTNNAC 3 cut(s) 52, 152, 217
Hpy8I GTNNAC 3 cut(s) 52, 152, 217
Hpy99I CGWCG 1 cut(s) 50
HpyAV CCTTC 2 cut(s) 58, 101
HpyCH4III ACNGT 1 cut(s) 56
HpyCH4IV ACGT 2 cut(s) 48, 154
HpyCH4V TGCA 1 cut(s) 128
HpyF3I CTNAG 1 cut(s) 15
HpySE526I ACGT 2 cut(s) 48, 154
HspAI GCGC 1 cut(s) 8
KspAI GTTAAC 1 cut(s) 217
Kzo9I GATC 1 cut(s) 121
LpnPI CCDG 2 cut(s) 25, 117
MaeI CTAG 2 cut(s) 183, 220
MaeII ACGT 2 cut(s) 48, 154
MaeIII GTNAC 2 cut(s) 56, 193
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MboII GAAGA 2 cut(s) 151, 188
MhlI GDGCHC 1 cut(s) 24
MluCI AATT 1 cut(s) 129
MnlI CCTC 1 cut(s) 172
MseI TTAA 2 cut(s) 87, 216
MvnI CGCG 1 cut(s) 10
NdeII GATC 1 cut(s) 121
NlaIV GGNNCC 1 cut(s) 21
NmuCI GTSAC 2 cut(s) 56, 193
PspN4I GGNNCC 1 cut(s) 21
PspPI GGNCC 1 cut(s) 42
SaqAI TTAA 2 cut(s) 87, 216
Sau3AI GATC 1 cut(s) 121
Sau96I GGNCC 1 cut(s) 42
SduI GDGCHC 1 cut(s) 24
SetI ASST 5 cut(s) 21, 41, 51, 157, 190
Sse9I AATT 1 cut(s) 129
SsiI CCGC 1 cut(s) 10
SspMI CTAG 2 cut(s) 183, 220
TaaI ACNGT 1 cut(s) 56
TaiI ACGT 2 cut(s) 51, 157
TaqI TCGA 1 cut(s) 81
TasI AATT 1 cut(s) 129
Tru1I TTAA 2 cut(s) 87, 216
Tru9I TTAA 2 cut(s) 87, 216
TseFI GTSAC 2 cut(s) 56, 193
Tsp45I GTSAC 2 cut(s) 56, 193
TspDTI ATGAA 1 cut(s) 189
XspI CTAG 2 cut(s) 183, 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.