Rmu_co8358963.1_g000001

Protein of unknown function (DUF674)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8358963.1
OG0000352
Physical Location & Seq
Reverse (-)
1 .. 747
747 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8358963.1_g000001.1.cds

Sequence Viewer

Length: 232 bp
atggttttgttcgccgaagccggcaaggacttcgtggactttctcttctcccttttatctttccccgtcggcactcttgtcaggcttctctccaaaaatggcatggtcggaagcctatgcaaactctacgagagtttcgaaaatctcaacggcatgtatatgcagcagcctaatctcaacagagacgtcctcctcaaacccaaagaaccagccggtgttcctaataacctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF674

Protein Analysis

77

Amino Acids

8.58

Weight (kDa)

6.11

Isoelectric Point (pI)

21.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000352)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g24890 FvH4_7g21280 FvH4_7g21300 FvH4_7g21300 FvH4_7g21310 FvH4_7g21330 FvH4_7g21340 FvH4_7g21600 FvH4_7g21610 FvH4_7g21630
malus_domestica MD07G1190400.v1.1 MD07G1190600.v1.1
prunus_persica Prupe.2G228600_v2.0.a1 Prupe.6G198200_v2.0.a1
pyrus_communis pycom07g18010
rosa_chinensis RchiOBHm_Chr1g0365711 RchiOBHm_Chr1g0365721 RchiOBHm_Chr1g0365731 RchiOBHm_Chr1g0365991 RchiOBHm_Chr5g0044511 RchiOBHm_Chr6g0247041 RchiOBHm_Chr6g0247081
rosa_laevigata RLG00000015223 RLG00000027405 RLG00000027406 RLG00000027407 RLG00000027408 RLG00000027409 RLG00000027411 RLG00000027413 RLG00000034277
rosa_multiflora Rmu_co8279495.1_g000001 Rmu_co8358963.1_g000001 Rmu_co8520123.1_g000003 Rmu_sc0002093.1_g000019 Rmu_sc0002093.1_g000024 Rmu_sc0002093.1_g000025 Rmu_sc0002093.1_g000029 Rmu_sc0002476.1_g000002 Rmu_sc0002476.1_g000021 Rmu_sc0003466.1_g000011 Rmu_sc0004288.1_g000006 Rmu_sc0004288.1_g000007 Rmu_sc0004311.1_g000022 Rmu_sc0004311.1_g000023 Rmu_sc0004311.1_g000026 Rmu_sc0004311.1_g000033 Rmu_sc0004577.1_g000008 Rmu_sc0004645.1_g000005 Rmu_sc0004645.1_g000006 Rmu_sc0006406.1_g000011 Rmu_sc0006406.1_g000012 Rmu_sc0009967.1_g000002 Rmu_sc0011598.1_g000003 Rmu_ssc0000151.1_g000015
rosa_roxburghii Rroxscaffold_1G00036500 Rroxscaffold_3G00276050 Rroxscaffold_4G00290950 Rroxscaffold_4G00290960 Rroxscaffold_4G00290970 Rroxscaffold_4G00290980 Rroxscaffold_4G00291000 Rroxscaffold_4G00291030 Rroxscaffold_4G00291060
rosa_rugosa Rorug01G0322900 Rorug01G0323000 Rorug01G0323100 Rorug01G0323200 Rorug01G0323300 Rorug01G0323400 Rorug01G0323500 Rorug01G0323600 Rorug05G0214700 Rorug05G0522100
rosa_samantha Rh1AG332000 Rh1AG332200 Rh1AG332300 Rh1AG334700 Rh1AG334800 Rh1AG335200 Rh1CG309900 Rh1CG310000 Rh1CG310100 Rh1DG325100 Rh1DG325300 Rh1DG325500 Rh5AG299000 Rh5BG306500 Rh5DG315800 Rh6AG037200 Rh6BG031900 Rh6BG032000 Rh6CG032300 Rh6CG032400 Rh6CG033200 Rh6DG030900
rosa_wichuraiana Rw0G001530 Rw1G019070 Rw1G029470 Rw1G029480 Rw1G029490 Rw1G029500 Rw1G029510 Rw1G029700 Rw5G027640 Rw5G027670 Rw6G003160 Rw6G003190

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 189
AcyI GRCGYC 1 cut(s) 186
Alw26I GTCTC 1 cut(s) 177
ApeKI GCWGC 2 cut(s) 163, 166
AsuII TTCGAA 1 cut(s) 138
BbvI GCAGC 2 cut(s) 175, 178
BceAI ACGGC 1 cut(s) 166
BcgI CGANNNNNNTGC 2 cut(s) 13, 47
BcoDI GTCTC 1 cut(s) 177
BfaI CTAG 1 cut(s) 230
BisI GCNGC 2 cut(s) 164, 167
BlsI GCNGC 2 cut(s) 165, 168
BplI GAGNNNNNCTC 2 cut(s) 174, 206
Bpu14I TTCGAA 1 cut(s) 138
BsaHI GRCGYC 1 cut(s) 186
Bse118I RCCGGY 2 cut(s) 20, 212
BseRI GAGGAG 1 cut(s) 182
BseXI GCAGC 2 cut(s) 175, 178
BsiSI CCGG 2 cut(s) 21, 213
BsmAI GTCTC 1 cut(s) 177
BsmBI CGTCTC 1 cut(s) 177
Bsp119I TTCGAA 1 cut(s) 138
BspT104I TTCGAA 1 cut(s) 138
BsrFI RCCGGY 2 cut(s) 20, 212
BssAI RCCGGY 2 cut(s) 20, 212
BssNI GRCGYC 1 cut(s) 186
Bst6I CTCTTC 1 cut(s) 50
BstACI GRCGYC 1 cut(s) 186
BstBI TTCGAA 1 cut(s) 138
BstC8I GCNNGC 1 cut(s) 22
BstMAI GTCTC 1 cut(s) 177
BstNSI RCATGY 1 cut(s) 157
BstV1I GCAGC 2 cut(s) 175, 178
Cac8I GCNNGC 1 cut(s) 22
Cfr10I RCCGGY 2 cut(s) 20, 212
CviAII CATG 2 cut(s) 103, 154
CviJI RGCY 5 cut(s) 20, 85, 114, 169, 212
CviKI_1 RGCY 5 cut(s) 20, 85, 114, 169, 212
Eam1104I CTCTTC 1 cut(s) 50
EarI CTCTTC 1 cut(s) 50
Esp3I CGTCTC 1 cut(s) 177
FaeI CATG 2 cut(s) 106, 157
FaiI YATR 5 cut(s) 104, 118, 155, 159, 161
FatI CATG 2 cut(s) 102, 153
Fnu4HI GCNGC 2 cut(s) 164, 167
Fsp4HI GCNGC 2 cut(s) 164, 167
FspBI CTAG 1 cut(s) 230
GluI GCNGC 2 cut(s) 164, 167
HapII CCGG 2 cut(s) 21, 213
Hin1I GRCGYC 1 cut(s) 186
Hin1II CATG 2 cut(s) 106, 157
HpaII CCGG 2 cut(s) 21, 213
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 110
Hpy8I GTNNAC 1 cut(s) 37
Hpy99I CGWCG 1 cut(s) 71
HpyCH4IV ACGT 1 cut(s) 186
HpyCH4V TGCA 2 cut(s) 120, 163
HpySE526I ACGT 1 cut(s) 186
Hsp92I GRCGYC 1 cut(s) 186
Hsp92II CATG 2 cut(s) 106, 157
KroI GCCGGC 1 cut(s) 20
KroNI GCCGGC 1 cut(s) 22
LpnPI CCDG 4 cut(s) 34, 67, 222, 226
Lsp1109I GCAGC 2 cut(s) 175, 178
MaeI CTAG 1 cut(s) 230
MaeII ACGT 1 cut(s) 186
MboII GAAGA 1 cut(s) 37
MmeI TCCRAC 1 cut(s) 88
MnlI CCTC 2 cut(s) 200, 203
MroNI GCCGGC 1 cut(s) 20
MslI CAYNNNNRTG 1 cut(s) 158
MspI CCGG 2 cut(s) 21, 213
NaeI GCCGGC 1 cut(s) 22
NgoMIV GCCGGC 1 cut(s) 20
NlaIII CATG 2 cut(s) 106, 157
NspI RCATGY 1 cut(s) 157
NspV TTCGAA 1 cut(s) 138
PcsI WCGNNNNNNNCGW 1 cut(s) 135
PdiI GCCGGC 1 cut(s) 22
PkrI GCNGC 2 cut(s) 165, 168
RseI CAYNNNNRTG 1 cut(s) 158
SatI GCNGC 2 cut(s) 164, 167
SetI ASST 2 cut(s) 189, 231
SfuI TTCGAA 1 cut(s) 138
SmiMI CAYNNNNRTG 1 cut(s) 158
SspMI CTAG 1 cut(s) 230
TaiI ACGT 1 cut(s) 189
TaqI TCGA 1 cut(s) 138
TseI GCWGC 2 cut(s) 163, 166
XceI RCATGY 1 cut(s) 157
XcmI CCANNNNNNNNNTGG 1 cut(s) 100
XspI CTAG 1 cut(s) 230
ZraI GACGTC 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.