Rmu_sc0004311.1_g000026

Protein of unknown function (DUF674)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004311.1
Physical Location & Seq
Reverse (-)
85957 .. 86589
633 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004311.1_g000026.1.cds

Sequence Viewer

Length: 633 bp
atggcaaccaccagcacccccaccaccaatgttactttgaagctcttgattgatacaaagggccacaaagttctgtatgctgaatcaggcaaggaatttgtggactttcttttcaccattatgtctttacccgtcggcactgtcattaggctcctcagcaaggatagcatggttggtagcttaggcaagctttacgatagtatcgaaaacattggtgacatttacatgctaccagattgtagcaaagatactttgctcaaacccaaagcggtaataggcagtggggatgcctctcttttgttaaccaaggatgagtcagtggcggaaaaaaagcttttcatgtgtgtgaactaccaccggtatgtggctgatgaccctagagccatatgtccacagtgtagaaactatctctccaccaaagtgccttatgttgctccacaggctactactgctggatcttctgggggtggtcgtggatatgtgaaagatgttgtgacatacatgattatggataatttggaggtgaagcctatgtctaccatatcttgtataactatgctcaacaagttcaatgttaaggaggttggttcccttgaagagaaggtagttcatctaggcatggatgaggtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

210

Amino Acids

22.96

Weight (kDa)

6.3

Isoelectric Point (pI)

30.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000352)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g24890 FvH4_7g21280 FvH4_7g21300 FvH4_7g21300 FvH4_7g21310 FvH4_7g21330 FvH4_7g21340 FvH4_7g21600 FvH4_7g21610 FvH4_7g21630
malus_domestica MD07G1190400.v1.1 MD07G1190600.v1.1
prunus_persica Prupe.2G228600_v2.0.a1 Prupe.6G198200_v2.0.a1
pyrus_communis pycom07g18010
rosa_chinensis RchiOBHm_Chr1g0365711 RchiOBHm_Chr1g0365721 RchiOBHm_Chr1g0365731 RchiOBHm_Chr1g0365991 RchiOBHm_Chr5g0044511 RchiOBHm_Chr6g0247041 RchiOBHm_Chr6g0247081
rosa_laevigata RLG00000015223 RLG00000027405 RLG00000027406 RLG00000027407 RLG00000027408 RLG00000027409 RLG00000027411 RLG00000027413 RLG00000034277
rosa_multiflora Rmu_co8279495.1_g000001 Rmu_co8358963.1_g000001 Rmu_co8520123.1_g000003 Rmu_sc0002093.1_g000019 Rmu_sc0002093.1_g000024 Rmu_sc0002093.1_g000025 Rmu_sc0002093.1_g000029 Rmu_sc0002476.1_g000002 Rmu_sc0002476.1_g000021 Rmu_sc0003466.1_g000011 Rmu_sc0004288.1_g000006 Rmu_sc0004288.1_g000007 Rmu_sc0004311.1_g000022 Rmu_sc0004311.1_g000023 Rmu_sc0004311.1_g000026 Rmu_sc0004311.1_g000033 Rmu_sc0004577.1_g000008 Rmu_sc0004645.1_g000005 Rmu_sc0004645.1_g000006 Rmu_sc0006406.1_g000011 Rmu_sc0006406.1_g000012 Rmu_sc0009967.1_g000002 Rmu_sc0011598.1_g000003 Rmu_ssc0000151.1_g000015
rosa_roxburghii Rroxscaffold_1G00036500 Rroxscaffold_3G00276050 Rroxscaffold_4G00290950 Rroxscaffold_4G00290960 Rroxscaffold_4G00290970 Rroxscaffold_4G00290980 Rroxscaffold_4G00291000 Rroxscaffold_4G00291030 Rroxscaffold_4G00291060
rosa_rugosa Rorug01G0322900 Rorug01G0323000 Rorug01G0323100 Rorug01G0323200 Rorug01G0323300 Rorug01G0323400 Rorug01G0323500 Rorug01G0323600 Rorug05G0214700 Rorug05G0522100
rosa_samantha Rh1AG332000 Rh1AG332200 Rh1AG332300 Rh1AG334700 Rh1AG334800 Rh1AG335200 Rh1CG309900 Rh1CG310000 Rh1CG310100 Rh1DG325100 Rh1DG325300 Rh1DG325500 Rh5AG299000 Rh5BG306500 Rh5DG315800 Rh6AG037200 Rh6BG031900 Rh6BG032000 Rh6CG032300 Rh6CG032400 Rh6CG033200 Rh6DG030900
rosa_wichuraiana Rw0G001530 Rw1G019070 Rw1G029470 Rw1G029480 Rw1G029490 Rw1G029500 Rw1G029510 Rw1G029700 Rw5G027640 Rw5G027670 Rw6G003160 Rw6G003190

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 536
AciI CCGC 2 cut(s) 269, 323
AclWI GGATC 1 cut(s) 463
AcsI RAATTY 1 cut(s) 95
AfiI CCNNNNNNNGG 2 cut(s) 160, 364
AgeI ACCGGT 1 cut(s) 357
AgsI TTSAA 3 cut(s) 40, 571, 596
AleI CACNNNNGTG 1 cut(s) 419
AluBI AGCT 4 cut(s) 43, 180, 190, 334
AluI AGCT 4 cut(s) 43, 180, 190, 334
AlwI GGATC 1 cut(s) 463
AoxI GGCC 1 cut(s) 61
ApoI RAATTY 1 cut(s) 95
AsiGI ACCGGT 1 cut(s) 357
AspS9I GGNCC 1 cut(s) 61
AsuHPI GGTGA 3 cut(s) 106, 227, 535
BaeI ACNNNNGTAYC 2 cut(s) 184, 217
BbvCI CCTCAGC 1 cut(s) 155
BfaI CTAG 2 cut(s) 378, 614
BmgT120I GGNCC 1 cut(s) 61
BmiI GGNNCC 2 cut(s) 152, 589
BmsI GCATC 1 cut(s) 277
Bpu10I CCTNAGC 2 cut(s) 155, 181
BsaJI CCNNGG 1 cut(s) 306
BsaWI WCCGGW 1 cut(s) 357
BsaXI ACNNNNNCTCC 2 cut(s) 395, 425
Bsc4I CCNNNNNNNGG 2 cut(s) 160, 364
Bse118I RCCGGY 1 cut(s) 357
BseDI CCNNGG 1 cut(s) 306
BseGI GGATG 3 cut(s) 292, 316, 628
BseLI CCNNNNNNNGG 2 cut(s) 160, 364
BseMII CTCAG 1 cut(s) 169
BseRI GAGGAG 1 cut(s) 143
BshFI GGCC 1 cut(s) 63
BshTI ACCGGT 1 cut(s) 357
BsiSI CCGG 1 cut(s) 358
BslI CCNNNNNNNGG 2 cut(s) 160, 364
BsnI GGCC 1 cut(s) 63
Bsp143I GATC 1 cut(s) 455
BspACI CCGC 2 cut(s) 269, 323
BspANI GGCC 1 cut(s) 63
BspCNI CTCAG 1 cut(s) 168
BspLI GGNNCC 2 cut(s) 152, 589
BspPI GGATC 1 cut(s) 463
BsrFI RCCGGY 1 cut(s) 357
BssAI RCCGGY 1 cut(s) 357
BssECI CCNNGG 1 cut(s) 306
BssMI GATC 1 cut(s) 455
BssT1I CCWWGG 1 cut(s) 306
Bst4CI ACNGT 2 cut(s) 142, 396
Bst6I CTCTTC 1 cut(s) 591
BstC8I GCNNGC 1 cut(s) 188
BstDEI CTNAG 2 cut(s) 155, 181
BstENI CCTNNNNNAGG 1 cut(s) 158
BstF5I GGATG 3 cut(s) 292, 316, 628
BstKTI GATC 1 cut(s) 458
BstMBI GATC 1 cut(s) 455
BstMWI GCNNNNNNNGC 3 cut(s) 165, 440, 449
BstNSI RCATGY 1 cut(s) 229
BstX2I RGATCY 1 cut(s) 455
BstYI RGATCY 1 cut(s) 455
BsuRI GGCC 1 cut(s) 63
BtsCI GGATG 3 cut(s) 292, 316, 628
BtsI GCAGTG 1 cut(s) 286
BtsIMutI CAGTG 4 cut(s) 138, 286, 324, 401
Cac8I GCNNGC 1 cut(s) 188
Cfr10I RCCGGY 1 cut(s) 357
Cfr13I GGNCC 1 cut(s) 61
CspAI ACCGGT 1 cut(s) 357
CviAII CATG 5 cut(s) 169, 226, 340, 502, 619
DdeI CTNAG 2 cut(s) 155, 181
DpnI GATC 1 cut(s) 457
DpnII GATC 1 cut(s) 455
Eam1104I CTCTTC 1 cut(s) 591
EarI CTCTTC 1 cut(s) 591
EciI GGCGGA 1 cut(s) 338
Eco130I CCWWGG 1 cut(s) 306
EcoNI CCTNNNNNAGG 1 cut(s) 158
EcoT14I CCWWGG 1 cut(s) 306
ErhI CCWWGG 1 cut(s) 306
FaeI CATG 5 cut(s) 172, 229, 343, 505, 622
FatI CATG 5 cut(s) 168, 225, 339, 501, 618
FauNDI CATATG 1 cut(s) 386
FblI GTMKAC 1 cut(s) 536
FokI GGATG 2 cut(s) 299, 323
FspBI CTAG 2 cut(s) 378, 614
HaeIII GGCC 1 cut(s) 63
HapII CCGG 1 cut(s) 358
Hin1II CATG 5 cut(s) 172, 229, 343, 505, 622
HincII GTYRAC 1 cut(s) 303
HindII GTYRAC 1 cut(s) 303
HindIII AAGCTT 2 cut(s) 188, 332
HinfI GANTC 2 cut(s) 83, 314
HpaI GTTAAC 1 cut(s) 303
HpaII CCGG 1 cut(s) 358
HphI GGTGA 3 cut(s) 106, 227, 535
Hpy166II GTNNAC 5 cut(s) 103, 303, 349, 392, 537
Hpy188III TCNNGA 1 cut(s) 46
Hpy8I GTNNAC 5 cut(s) 103, 303, 349, 392, 537
Hpy99I CGWCG 1 cut(s) 137
HpyAV CCTTC 1 cut(s) 595
HpyCH4III ACNGT 2 cut(s) 142, 396
HpyF10VI GCNNNNNNNGC 3 cut(s) 165, 440, 449
HpyF3I CTNAG 2 cut(s) 155, 181
Hsp92II CATG 5 cut(s) 172, 229, 343, 505, 622
KspAI GTTAAC 1 cut(s) 303
Kzo9I GATC 1 cut(s) 455
LmnI GCTCC 2 cut(s) 156, 439
LpnPI CCDG 7 cut(s) 25, 72, 246, 371, 425, 438, 447
LweI GCATC 1 cut(s) 277
MaeI CTAG 2 cut(s) 378, 614
MaeIII GTNAC 3 cut(s) 31, 215, 493
MalI GATC 1 cut(s) 457
MboI GATC 1 cut(s) 455
MboII GAAGA 2 cut(s) 450, 608
MflI RGATCY 1 cut(s) 455
MluCI AATT 2 cut(s) 95, 514
MlyI GAGTC 1 cut(s) 323
MnlI CCTC 5 cut(s) 164, 301, 514, 574, 619
MseI TTAA 2 cut(s) 302, 576
MslI CAYNNNNRTG 6 cut(s) 119, 224, 344, 360, 419, 506
MspI CCGG 1 cut(s) 358
MwoI GCNNNNNNNGC 3 cut(s) 165, 440, 449
NdeI CATATG 1 cut(s) 386
NdeII GATC 1 cut(s) 455
NlaIII CATG 5 cut(s) 172, 229, 343, 505, 622
NlaIV GGNNCC 2 cut(s) 152, 589
NmuCI GTSAC 2 cut(s) 215, 493
NspI RCATGY 1 cut(s) 229
OliI CACNNNNGTG 1 cut(s) 419
PcsI WCGNNNNNNNCGW 1 cut(s) 201
PfeI GAWTC 1 cut(s) 83
PinAI ACCGGT 1 cut(s) 357
PleI GAGTC 1 cut(s) 322
PpsI GAGTC 1 cut(s) 322
PspN4I GGNNCC 2 cut(s) 152, 589
PspPI GGNCC 1 cut(s) 61
PsuI RGATCY 1 cut(s) 455
RseI CAYNNNNRTG 6 cut(s) 119, 224, 344, 360, 419, 506
SaqAI TTAA 2 cut(s) 302, 576
Sau3AI GATC 1 cut(s) 455
Sau96I GGNCC 1 cut(s) 61
SchI GAGTC 1 cut(s) 323
SetI ASST 8 cut(s) 45, 182, 192, 336, 525, 585, 606, 630
SfaNI GCATC 1 cut(s) 277
SmiMI CAYNNNNRTG 6 cut(s) 119, 224, 344, 360, 419, 506
Sse9I AATT 2 cut(s) 95, 514
SsiI CCGC 2 cut(s) 269, 323
SspMI CTAG 2 cut(s) 378, 614
StyI CCWWGG 1 cut(s) 306
TaaI ACNGT 2 cut(s) 142, 396
TaqI TCGA 1 cut(s) 204
TasI AATT 2 cut(s) 95, 514
TfiI GAWTC 1 cut(s) 83
Tru1I TTAA 2 cut(s) 302, 576
Tru9I TTAA 2 cut(s) 302, 576
TscAI CASTG 4 cut(s) 145, 286, 324, 401
TseFI GTSAC 2 cut(s) 215, 493
Tsp45I GTSAC 2 cut(s) 215, 493
TspDTI ATGAA 2 cut(s) 328, 599
TspRI CASTG 4 cut(s) 145, 286, 324, 401
XagI CCTNNNNNAGG 1 cut(s) 158
XapI RAATTY 1 cut(s) 95
XceI RCATGY 1 cut(s) 229
XmiI GTMKAC 1 cut(s) 536
XspI CTAG 2 cut(s) 378, 614
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.