Rmu_sc0001167.1_g000031

transposon protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001167.1
OG0000178
Physical Location & Seq
Reverse (-)
139991 .. 140377
387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001167.1_g000031.1.cds

Sequence Viewer

Length: 249 bp
atggtgattgataaatcttggatgcagttaagtagatcagacccaaagtatgatcaaggagttacagagtttcttgattatgcatatagccatgataagtgggtagaggatgacatgataatatgtccatgcaaagacaatattgcaacagattcaagtgcacaccatgatgaagatggtactgatgaagatggtgatgaagatgttgctgatgagtatgatgcaaactctaatgaggacttttattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4216 DUF4218 Transpos_assoc Transposase_21

Protein Analysis

82

Amino Acids

9.46

Weight (kDa)

4.05

Isoelectric Point (pI)

49.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000178)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G40087 AT3G30200
fragaria_vesca FvH4_1g23271 FvH4_3g22812 FvH4_3g22813 FvH4_3g31042 FvH4_3g31043 FvH4_7g03653
malus_domestica MD05G1321200.v1.1 MD09G1027200.v1.1 MD15G1434900.v1.1 MD15G1435000.v1.1 MD15G1435100.v1.1
prunus_persica Prupe.1G578800_v2.0.a1 Prupe.1G578800_v2.0.a1 Prupe.1G578800_v2.0.a1 Prupe.2G062700_v2.0.a1 Prupe.5G033400_v2.0.a1 Prupe.7G022900_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1
pyrus_communis pycom03g07600 pycom03g11360 pycom05g02870 pycom111g02130 pycom15g38370 pycom15g38380
rosa_chinensis RchiOBHm_Chr1g0346371 RchiOBHm_Chr4g0402051 RchiOBHm_Chr4g0414991 RchiOBHm_Chr5g0051011 RchiOBHm_Chr5g0051181 RchiOBHm_Chr6g0273071 RchiOBHm_Chr7g0218301 RchiOBHm_Chr7g0241081
rosa_laevigata RLG00000007709 RLG00000008953 RLG00000012400 RLG00000012401 RLG00000013805 RLG00000014199 RLG00000014726 RLG00000017792 RLG00000017793 RLG00000018860 RLG00000020749 RLG00000030708 RLG00000033507
rosa_multiflora Rmu_co8373761.1_g000001 Rmu_sc0000028.1_g000023 Rmu_sc0000235.1_g000040 Rmu_sc0000293.1_g000017 Rmu_sc0000293.1_g000019 Rmu_sc0000651.1_g000012 Rmu_sc0000870.1_g000051 Rmu_sc0001167.1_g000031 Rmu_sc0001373.1_g000039 Rmu_sc0001861.1_g000055 Rmu_sc0001891.1_g000038 Rmu_sc0001909.1_g000015 Rmu_sc0002500.1_g000002 Rmu_sc0002868.1_g000036 Rmu_sc0002868.1_g000038 Rmu_sc0002868.1_g000039 Rmu_sc0003379.1_g000001 Rmu_sc0003778.1_g000005 Rmu_sc0003778.1_g000006 Rmu_sc0010475.1_g000011 Rmu_sc0015271.1_g000002 Rmu_sc0015271.1_g000003 Rmu_sc0017962.1_g000001 Rmu_sc0017962.1_g000003 Rmu_sc0022129.1_g000004 Rmu_sc0025694.1_g000003 Rmu_sc0025694.1_g000004
rosa_roxburghii Rroxscaffold_1G00031640 Rroxscaffold_1G00047620 Rroxscaffold_1G00047630 Rroxscaffold_1G00050560 Rroxscaffold_1G00050570 Rroxscaffold_1G00054800 Rroxscaffold_1G00055890 Rroxscaffold_2G00108230 Rroxscaffold_3G00240860 Rroxscaffold_4G00299670 Rroxscaffold_4G00299680 Rroxscaffold_4G00299690 Rroxscaffold_4G00306320 Rroxscaffold_4G00306340 Rroxscaffold_5G00341060 Rroxscaffold_5G00342000 Rroxscaffold_5G00355660 Rroxscaffold_5G00357170 Rroxscaffold_6G00399490 Rroxscaffold_6G00408400 Rroxscaffold_7G00189260 Rroxscaffold_7G00199620 Rroxscaffold_7G00215470
rosa_rugosa Rorug02G0117600 Rorug02G0117700 Rorug04G0116400 Rorug06G0103200
rosa_samantha Rh1AG062800 Rh1AG073700 Rh1CG091700 Rh1DG077600 Rh1DG077700 Rh1DG077800 Rh1DG117400 Rh1DG146300 Rh2BG193300 Rh2BG193400 Rh2BG265300 Rh2BG413400 Rh3CG365500 Rh4AG315400 Rh4BG323100 Rh4BG323200 Rh4CG071400 Rh4CG142500 Rh4CG203300 Rh4CG338300 Rh4DG079300 Rh4DG079400 Rh4DG217000 Rh4DG217100 Rh4DG217200 Rh4DG217300 Rh5AG128300 Rh5AG239900 Rh5AG465900 Rh5BG348600 Rh5BG387900 Rh5BG388000 Rh5CG181800 Rh5CG181900 Rh5CG271000 Rh5CG271100 Rh5DG127100 Rh5DG138400 Rh5DG168200 Rh5DG168300 Rh5DG361500 Rh5DG460400 Rh6AG045400 Rh6AG058600 Rh6BG275000 Rh6CG089700 Rh6DG182300 Rh6DG182400 Rh6DG207300 Rh6DG207400 Rh7BG374000 Rh7BG390600 Rh7BG390700 Rh7BG390800
rosa_wichuraiana Rw0G018690 Rw1G007320 Rw4G008510 Rw5G011510 Rw5G021830 Rw6G024150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 181
AgsI TTSAA 1 cut(s) 156
Alw21I GWGCWC 1 cut(s) 163
Alw44I GTGCAC 1 cut(s) 159
ApaLI GTGCAC 1 cut(s) 159
AsuHPI GGTGA 2 cut(s) 16, 206
BaeGI GKGCMC 1 cut(s) 163
Bbv12I GWGCWC 1 cut(s) 163
BccI CCATC 2 cut(s) 170, 185
BclI TGATCA 1 cut(s) 52
BmsI GCATC 2 cut(s) 12, 211
BseGI GGATG 2 cut(s) 27, 115
BseSI GKGCMC 1 cut(s) 163
BsiHKAI GWGCWC 1 cut(s) 163
Bsp1286I GDGCHC 1 cut(s) 163
Bsp143I GATC 2 cut(s) 35, 52
BssMI GATC 2 cut(s) 35, 52
BstF5I GGATG 2 cut(s) 27, 115
BstKTI GATC 2 cut(s) 38, 55
BstMBI GATC 2 cut(s) 35, 52
BstSLI GKGCMC 1 cut(s) 163
BtsCI GGATG 2 cut(s) 27, 115
Csp6I GTAC 1 cut(s) 180
CviAII CATG 4 cut(s) 92, 115, 129, 167
CviJI RGCY 1 cut(s) 90
CviKI_1 RGCY 1 cut(s) 90
CviQI GTAC 1 cut(s) 180
DpnI GATC 2 cut(s) 37, 54
DpnII GATC 2 cut(s) 35, 52
EcoT22I ATGCAT 1 cut(s) 85
FaeI CATG 4 cut(s) 95, 118, 132, 170
FatI CATG 4 cut(s) 91, 114, 128, 166
FbaI TGATCA 1 cut(s) 52
FokI GGATG 2 cut(s) 34, 122
Hin1II CATG 4 cut(s) 95, 118, 132, 170
HinfI GANTC 1 cut(s) 152
HphI GGTGA 2 cut(s) 16, 206
Hpy166II GTNNAC 1 cut(s) 161
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 74
Hpy8I GTNNAC 1 cut(s) 161
HpyCH4V TGCA 6 cut(s) 25, 83, 132, 146, 161, 224
Hsp92II CATG 4 cut(s) 95, 118, 132, 170
Ksp22I TGATCA 1 cut(s) 52
Kzo9I GATC 2 cut(s) 35, 52
LweI GCATC 2 cut(s) 12, 211
MaeIII GTNAC 1 cut(s) 61
MalI GATC 2 cut(s) 37, 54
MboI GATC 2 cut(s) 35, 52
MboII GAAGA 3 cut(s) 185, 200, 212
MhlI GDGCHC 1 cut(s) 163
MnlI CCTC 2 cut(s) 100, 229
Mph1103I ATGCAT 1 cut(s) 85
MseI TTAA 1 cut(s) 29
MslI CAYNNNNRTG 1 cut(s) 168
NdeII GATC 2 cut(s) 35, 52
NlaIII CATG 4 cut(s) 95, 118, 132, 170
NsiI ATGCAT 1 cut(s) 85
PfeI GAWTC 1 cut(s) 152
RsaI GTAC 1 cut(s) 181
RsaNI GTAC 1 cut(s) 180
RseI CAYNNNNRTG 1 cut(s) 168
SaqAI TTAA 1 cut(s) 29
Sau3AI GATC 2 cut(s) 35, 52
SduI GDGCHC 1 cut(s) 163
SfaNI GCATC 2 cut(s) 12, 211
SgeI CNNG 8 cut(s) 30, 68, 86, 104, 127, 141, 168, 179
SmiMI CAYNNNNRTG 1 cut(s) 168
SspI AATATT 1 cut(s) 142
TfiI GAWTC 1 cut(s) 152
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TspDTI ATGAA 3 cut(s) 186, 201, 213
VneI GTGCAC 1 cut(s) 159
XcmI CCANNNNNNNNNTGG 1 cut(s) 173
Zsp2I ATGCAT 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.