Rmu_sc0003379.1_g000001

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003379.1
OG0000178
Physical Location & Seq
Forward (+)
1413 .. 2791
1379 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003379.1_g000001.1.cds

Sequence Viewer

Length: 438 bp
atgtgcagtgatcctgcgcaatcaaagactgcgtttgttacattcaaggatgccaaagctcttgaaattgcactcttgttatcggctcttgttcttgggttacatgttcttgttcttcgttcctctggaaaaccaacccctttggaagagatgaagaatctacaaaacgagccacaaatgaatgaagaaattggtgaaataatgtctgaagatgagatccatgataaagttctttcgaaaattgttggtccacctcgatcaggctatatacgaggcttaggagctgggccaaagcctaaaagatctaaacttgcagcaagtgatgctcaactgagggaggcaaatcaaagggcagatcaagcagaaagacgagcaatgcagcttgcagaggagttgatggctgtgaagtctactgcagctcaggaaaatgaggagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RRM_1

Protein Analysis

145

Amino Acids

15.82

Weight (kDa)

5.53

Isoelectric Point (pI)

52.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000178)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G40087 AT3G30200
fragaria_vesca FvH4_1g23271 FvH4_3g22812 FvH4_3g22813 FvH4_3g31042 FvH4_3g31043 FvH4_7g03653
malus_domestica MD05G1321200.v1.1 MD09G1027200.v1.1 MD15G1434900.v1.1 MD15G1435000.v1.1 MD15G1435100.v1.1
prunus_persica Prupe.1G578800_v2.0.a1 Prupe.1G578800_v2.0.a1 Prupe.1G578800_v2.0.a1 Prupe.2G062700_v2.0.a1 Prupe.5G033400_v2.0.a1 Prupe.7G022900_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1
pyrus_communis pycom03g07600 pycom03g11360 pycom05g02870 pycom111g02130 pycom15g38370 pycom15g38380
rosa_chinensis RchiOBHm_Chr1g0346371 RchiOBHm_Chr4g0402051 RchiOBHm_Chr4g0414991 RchiOBHm_Chr5g0051011 RchiOBHm_Chr5g0051181 RchiOBHm_Chr6g0273071 RchiOBHm_Chr7g0218301 RchiOBHm_Chr7g0241081
rosa_laevigata RLG00000007709 RLG00000008953 RLG00000012400 RLG00000012401 RLG00000013805 RLG00000014199 RLG00000014726 RLG00000017792 RLG00000017793 RLG00000018860 RLG00000020749 RLG00000030708 RLG00000033507
rosa_multiflora Rmu_co8373761.1_g000001 Rmu_sc0000028.1_g000023 Rmu_sc0000235.1_g000040 Rmu_sc0000293.1_g000017 Rmu_sc0000293.1_g000019 Rmu_sc0000651.1_g000012 Rmu_sc0000870.1_g000051 Rmu_sc0001167.1_g000031 Rmu_sc0001373.1_g000039 Rmu_sc0001861.1_g000055 Rmu_sc0001891.1_g000038 Rmu_sc0001909.1_g000015 Rmu_sc0002500.1_g000002 Rmu_sc0002868.1_g000036 Rmu_sc0002868.1_g000038 Rmu_sc0002868.1_g000039 Rmu_sc0003379.1_g000001 Rmu_sc0003778.1_g000005 Rmu_sc0003778.1_g000006 Rmu_sc0010475.1_g000011 Rmu_sc0015271.1_g000002 Rmu_sc0015271.1_g000003 Rmu_sc0017962.1_g000001 Rmu_sc0017962.1_g000003 Rmu_sc0022129.1_g000004 Rmu_sc0025694.1_g000003 Rmu_sc0025694.1_g000004
rosa_roxburghii Rroxscaffold_1G00031640 Rroxscaffold_1G00047620 Rroxscaffold_1G00047630 Rroxscaffold_1G00050560 Rroxscaffold_1G00050570 Rroxscaffold_1G00054800 Rroxscaffold_1G00055890 Rroxscaffold_2G00108230 Rroxscaffold_3G00240860 Rroxscaffold_4G00299670 Rroxscaffold_4G00299680 Rroxscaffold_4G00299690 Rroxscaffold_4G00306320 Rroxscaffold_4G00306340 Rroxscaffold_5G00341060 Rroxscaffold_5G00342000 Rroxscaffold_5G00355660 Rroxscaffold_5G00357170 Rroxscaffold_6G00399490 Rroxscaffold_6G00408400 Rroxscaffold_7G00189260 Rroxscaffold_7G00199620 Rroxscaffold_7G00215470
rosa_rugosa Rorug02G0117600 Rorug02G0117700 Rorug04G0116400 Rorug06G0103200
rosa_samantha Rh1AG062800 Rh1AG073700 Rh1CG091700 Rh1DG077600 Rh1DG077700 Rh1DG077800 Rh1DG117400 Rh1DG146300 Rh2BG193300 Rh2BG193400 Rh2BG265300 Rh2BG413400 Rh3CG365500 Rh4AG315400 Rh4BG323100 Rh4BG323200 Rh4CG071400 Rh4CG142500 Rh4CG203300 Rh4CG338300 Rh4DG079300 Rh4DG079400 Rh4DG217000 Rh4DG217100 Rh4DG217200 Rh4DG217300 Rh5AG128300 Rh5AG239900 Rh5AG465900 Rh5BG348600 Rh5BG387900 Rh5BG388000 Rh5CG181800 Rh5CG181900 Rh5CG271000 Rh5CG271100 Rh5DG127100 Rh5DG138400 Rh5DG168200 Rh5DG168300 Rh5DG361500 Rh5DG460400 Rh6AG045400 Rh6AG058600 Rh6BG275000 Rh6CG089700 Rh6DG182300 Rh6DG182400 Rh6DG207300 Rh6DG207400 Rh7BG374000 Rh7BG390600 Rh7BG390700 Rh7BG390800
rosa_wichuraiana Rw0G018690 Rw1G007320 Rw4G008510 Rw5G011510 Rw5G021830 Rw6G024150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 18
AccI GTMKAC 1 cut(s) 410
AclWI GGATC 2 cut(s) 5, 211
AcuI CTGAAG 1 cut(s) 228
AfiI CCNNNNNNNGG 1 cut(s) 260
AflIII ACRYGT 1 cut(s) 103
AgsI TTSAA 2 cut(s) 46, 65
AluBI AGCT 4 cut(s) 59, 284, 382, 419
AluI AGCT 4 cut(s) 59, 284, 382, 419
AlwI GGATC 2 cut(s) 5, 211
AoxI GGCC 1 cut(s) 287
ApeKI GCWGC 3 cut(s) 314, 379, 416
AspLEI GCGC 1 cut(s) 19
AspS9I GGNCC 2 cut(s) 248, 287
AsuHPI GGTGA 1 cut(s) 206
AsuII TTCGAA 1 cut(s) 236
AvaII GGWCC 1 cut(s) 248
BbvI GCAGC 3 cut(s) 326, 391, 428
BccI CCATC 1 cut(s) 391
BfmI CTRYAG 1 cut(s) 414
BglII AGATCT 1 cut(s) 302
BisI GCNGC 3 cut(s) 315, 380, 417
BlsI GCNGC 3 cut(s) 316, 381, 418
Bme18I GGWCC 1 cut(s) 248
BmgT120I GGNCC 2 cut(s) 248, 287
BmsI GCATC 2 cut(s) 40, 313
Bpu10I CCTNAGC 2 cut(s) 277, 420
Bpu14I TTCGAA 1 cut(s) 236
Bsc4I CCNNNNNNNGG 1 cut(s) 260
Bse3DI GCAATG 1 cut(s) 381
BseGI GGATG 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 260
BseMI GCAATG 1 cut(s) 381
BseMII CTCAG 2 cut(s) 323, 434
BseRI GAGGAG 1 cut(s) 404
BseXI GCAGC 3 cut(s) 326, 391, 428
BseYI CCCAGC 1 cut(s) 284
BsgI GTGCAG 1 cut(s) 25
BshFI GGCC 1 cut(s) 289
BslI CCNNNNNNNGG 1 cut(s) 260
BsnI GGCC 1 cut(s) 289
Bsp119I TTCGAA 1 cut(s) 236
Bsp143I GATC 5 cut(s) 10, 216, 257, 302, 355
BspANI GGCC 1 cut(s) 289
BspCNI CTCAG 2 cut(s) 324, 433
BspMAI CTGCAG 1 cut(s) 418
BspPI GGATC 2 cut(s) 5, 211
BspT104I TTCGAA 1 cut(s) 236
BsrDI GCAATG 1 cut(s) 381
BssMI GATC 5 cut(s) 10, 216, 257, 302, 355
Bst6I CTCTTC 1 cut(s) 141
BstAPI GCANNNNNTGC 1 cut(s) 323
BstBI TTCGAA 1 cut(s) 236
BstC8I GCNNGC 1 cut(s) 384
BstDEI CTNAG 3 cut(s) 277, 332, 420
BstENI CCTNNNNNAGG 1 cut(s) 258
BstF5I GGATG 1 cut(s) 55
BstHHI GCGC 1 cut(s) 19
BstKTI GATC 5 cut(s) 13, 219, 260, 305, 358
BstMBI GATC 5 cut(s) 10, 216, 257, 302, 355
BstMWI GCNNNNNNNGC 2 cut(s) 323, 359
BstNSI RCATGY 1 cut(s) 107
BstSFI CTRYAG 1 cut(s) 414
BstV1I GCAGC 3 cut(s) 326, 391, 428
BstX2I RGATCY 2 cut(s) 216, 302
BstYI RGATCY 2 cut(s) 216, 302
BsuRI GGCC 1 cut(s) 289
BtsCI GGATG 1 cut(s) 55
BtsI GCAGTG 1 cut(s) 13
BtsIMutI CAGTG 1 cut(s) 13
Cac8I GCNNGC 1 cut(s) 384
CfoI GCGC 1 cut(s) 19
Cfr13I GGNCC 2 cut(s) 248, 287
CviAII CATG 2 cut(s) 104, 221
DdeI CTNAG 3 cut(s) 277, 332, 420
DpnI GATC 5 cut(s) 12, 218, 259, 304, 357
DpnII GATC 5 cut(s) 10, 216, 257, 302, 355
Eam1104I CTCTTC 1 cut(s) 141
EarI CTCTTC 1 cut(s) 141
Eco47I GGWCC 1 cut(s) 248
Eco57I CTGAAG 1 cut(s) 228
EcoNI CCTNNNNNAGG 1 cut(s) 258
FaeI CATG 2 cut(s) 107, 224
FaiI YATR 4 cut(s) 105, 222, 267, 269
FatI CATG 2 cut(s) 103, 220
FblI GTMKAC 1 cut(s) 410
Fnu4HI GCNGC 3 cut(s) 315, 380, 417
FokI GGATG 1 cut(s) 62
Fsp4HI GCNGC 3 cut(s) 315, 380, 417
FspI TGCGCA 1 cut(s) 18
GlaI GCGC 1 cut(s) 18
GluI GCNGC 3 cut(s) 315, 380, 417
GsaI CCCAGC 1 cut(s) 288
HaeIII GGCC 1 cut(s) 289
HhaI GCGC 1 cut(s) 19
Hin1II CATG 2 cut(s) 107, 224
Hin6I GCGC 1 cut(s) 17
HinP1I GCGC 1 cut(s) 17
HinfI GANTC 1 cut(s) 157
HphI GGTGA 1 cut(s) 206
Hpy166II GTNNAC 2 cut(s) 251, 411
Hpy188I TCNGA 1 cut(s) 208
Hpy188III TCNNGA 3 cut(s) 62, 126, 422
Hpy8I GTNNAC 2 cut(s) 251, 411
HpyCH4V TGCA 6 cut(s) 6, 71, 314, 379, 386, 416
HpyF10VI GCNNNNNNNGC 2 cut(s) 323, 359
HpyF3I CTNAG 3 cut(s) 277, 332, 420
Hsp92II CATG 2 cut(s) 107, 224
HspAI GCGC 1 cut(s) 17
Kzo9I GATC 5 cut(s) 10, 216, 257, 302, 355
LmnI GCTCC 1 cut(s) 281
LpnPI CCDG 5 cut(s) 27, 111, 246, 270, 407
Lsp1109I GCAGC 3 cut(s) 326, 391, 428
LweI GCATC 2 cut(s) 40, 313
MaeIII GTNAC 2 cut(s) 37, 99
MalI GATC 5 cut(s) 12, 218, 259, 304, 357
MboI GATC 5 cut(s) 10, 216, 257, 302, 355
MboII GAAGA 5 cut(s) 107, 158, 166, 197, 221
MflI RGATCY 2 cut(s) 216, 302
MluCI AATT 3 cut(s) 66, 189, 240
MnlI CCTC 7 cut(s) 133, 264, 266, 327, 331, 382, 424
MwoI GCNNNNNNNGC 2 cut(s) 323, 359
NdeII GATC 5 cut(s) 10, 216, 257, 302, 355
NlaIII CATG 2 cut(s) 107, 224
NsbI TGCGCA 1 cut(s) 18
NspI RCATGY 1 cut(s) 107
NspV TTCGAA 1 cut(s) 236
PciI ACATGT 1 cut(s) 103
PfeI GAWTC 1 cut(s) 157
PkrI GCNGC 3 cut(s) 316, 381, 418
PscI ACATGT 1 cut(s) 103
PspFI CCCAGC 1 cut(s) 284
PspPI GGNCC 2 cut(s) 248, 287
PstI CTGCAG 1 cut(s) 418
PsuI RGATCY 2 cut(s) 216, 302
SatI GCNGC 3 cut(s) 315, 380, 417
Sau3AI GATC 5 cut(s) 10, 216, 257, 302, 355
Sau96I GGNCC 2 cut(s) 248, 287
SetI ASST 5 cut(s) 61, 256, 286, 384, 421
SfaNI GCATC 2 cut(s) 40, 313
SfcI CTRYAG 1 cut(s) 414
SfuI TTCGAA 1 cut(s) 236
SinI GGWCC 1 cut(s) 248
Sse9I AATT 3 cut(s) 66, 189, 240
TaqI TCGA 2 cut(s) 236, 256
TasI AATT 3 cut(s) 66, 189, 240
TfiI GAWTC 1 cut(s) 157
TscAI CASTG 1 cut(s) 13
TseI GCWGC 3 cut(s) 314, 379, 416
TspDTI ATGAA 3 cut(s) 167, 194, 198
TspRI CASTG 1 cut(s) 13
VpaK11BI GGWCC 1 cut(s) 248
XagI CCTNNNNNAGG 1 cut(s) 258
XceI RCATGY 1 cut(s) 107
XmiI GTMKAC 1 cut(s) 410
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.