Rmu_sc0001891.1_g000038

Plant transposase (Ptta/En/Spm family)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001891.1
Physical Location & Seq
Forward (+)
152468 .. 153476
1009 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001891.1_g000038.1.cds

Sequence Viewer

Length: 645 bp
atggagaatcaacctgaagatgttgaagaggatgattggaactacttaattgcaaatctgtggcaagatcaaaagtggctgcgaaatcctgaaactggagaggaaattggtcgtattgaccttttcaagctcacacgatacagtgaaaagaaatctgcatgggttggtgatacagcaaagaatgcttttgaagagatgaaaattctacaaaacgagccacaaatgaatgaaaaatctggtgaaataatgtctgaagatgagatctatgatgaagtgctttccaaaattgttggtccaccacgatcaagctatatacgtggcttaggagcaggcccaaagcctaaaaggtctaaattttctgcaaatgatgctcaagtgagggaggcgaatcaaagggcagatgaagcggaaagaagagcaatgcagcttgcagatgaattgatggctgtaaagtctactgcagctcagcaaaatgaggagttagagatggtcaaagctagtgcagctgaacaaaatgaagagttagaggcagtgaaggttagagctgctcaacaaaatgaagagttggaggcattaaaggcaagacaaaatcagactgacacacttttactcaaactgatggcgcagttgtcctcccaaaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

214

Amino Acids

24.4

Weight (kDa)

4.7

Isoelectric Point (pI)

44.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000178)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G40087 AT3G30200
fragaria_vesca FvH4_1g23271 FvH4_3g22812 FvH4_3g22813 FvH4_3g31042 FvH4_3g31043 FvH4_7g03653
malus_domestica MD05G1321200.v1.1 MD09G1027200.v1.1 MD15G1434900.v1.1 MD15G1435000.v1.1 MD15G1435100.v1.1
prunus_persica Prupe.1G578800_v2.0.a1 Prupe.1G578800_v2.0.a1 Prupe.1G578800_v2.0.a1 Prupe.2G062700_v2.0.a1 Prupe.5G033400_v2.0.a1 Prupe.7G022900_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1
pyrus_communis pycom03g07600 pycom03g11360 pycom05g02870 pycom111g02130 pycom15g38370 pycom15g38380
rosa_chinensis RchiOBHm_Chr1g0346371 RchiOBHm_Chr4g0402051 RchiOBHm_Chr4g0414991 RchiOBHm_Chr5g0051011 RchiOBHm_Chr5g0051181 RchiOBHm_Chr6g0273071 RchiOBHm_Chr7g0218301 RchiOBHm_Chr7g0241081
rosa_laevigata RLG00000007709 RLG00000008953 RLG00000012400 RLG00000012401 RLG00000013805 RLG00000014199 RLG00000014726 RLG00000017792 RLG00000017793 RLG00000018860 RLG00000020749 RLG00000030708 RLG00000033507
rosa_multiflora Rmu_co8373761.1_g000001 Rmu_sc0000028.1_g000023 Rmu_sc0000235.1_g000040 Rmu_sc0000293.1_g000017 Rmu_sc0000293.1_g000019 Rmu_sc0000651.1_g000012 Rmu_sc0000870.1_g000051 Rmu_sc0001167.1_g000031 Rmu_sc0001373.1_g000039 Rmu_sc0001861.1_g000055 Rmu_sc0001891.1_g000038 Rmu_sc0001909.1_g000015 Rmu_sc0002500.1_g000002 Rmu_sc0002868.1_g000036 Rmu_sc0002868.1_g000038 Rmu_sc0002868.1_g000039 Rmu_sc0003379.1_g000001 Rmu_sc0003778.1_g000005 Rmu_sc0003778.1_g000006 Rmu_sc0010475.1_g000011 Rmu_sc0015271.1_g000002 Rmu_sc0015271.1_g000003 Rmu_sc0017962.1_g000001 Rmu_sc0017962.1_g000003 Rmu_sc0022129.1_g000004 Rmu_sc0025694.1_g000003 Rmu_sc0025694.1_g000004
rosa_roxburghii Rroxscaffold_1G00031640 Rroxscaffold_1G00047620 Rroxscaffold_1G00047630 Rroxscaffold_1G00050560 Rroxscaffold_1G00050570 Rroxscaffold_1G00054800 Rroxscaffold_1G00055890 Rroxscaffold_2G00108230 Rroxscaffold_3G00240860 Rroxscaffold_4G00299670 Rroxscaffold_4G00299680 Rroxscaffold_4G00299690 Rroxscaffold_4G00306320 Rroxscaffold_4G00306340 Rroxscaffold_5G00341060 Rroxscaffold_5G00342000 Rroxscaffold_5G00355660 Rroxscaffold_5G00357170 Rroxscaffold_6G00399490 Rroxscaffold_6G00408400 Rroxscaffold_7G00189260 Rroxscaffold_7G00199620 Rroxscaffold_7G00215470
rosa_rugosa Rorug02G0117600 Rorug02G0117700 Rorug04G0116400 Rorug06G0103200
rosa_samantha Rh1AG062800 Rh1AG073700 Rh1CG091700 Rh1DG077600 Rh1DG077700 Rh1DG077800 Rh1DG117400 Rh1DG146300 Rh2BG193300 Rh2BG193400 Rh2BG265300 Rh2BG413400 Rh3CG365500 Rh4AG315400 Rh4BG323100 Rh4BG323200 Rh4CG071400 Rh4CG142500 Rh4CG203300 Rh4CG338300 Rh4DG079300 Rh4DG079400 Rh4DG217000 Rh4DG217100 Rh4DG217200 Rh4DG217300 Rh5AG128300 Rh5AG239900 Rh5AG465900 Rh5BG348600 Rh5BG387900 Rh5BG388000 Rh5CG181800 Rh5CG181900 Rh5CG271000 Rh5CG271100 Rh5DG127100 Rh5DG138400 Rh5DG168200 Rh5DG168300 Rh5DG361500 Rh5DG460400 Rh6AG045400 Rh6AG058600 Rh6BG275000 Rh6CG089700 Rh6DG182300 Rh6DG182400 Rh6DG207300 Rh6DG207400 Rh7BG374000 Rh7BG390600 Rh7BG390700 Rh7BG390800
rosa_wichuraiana Rw0G018690 Rw1G007320 Rw4G008510 Rw5G011510 Rw5G021830 Rw6G024150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 455
AciI CCGC 1 cut(s) 407
AcsI RAATTY 2 cut(s) 201, 353
AcuI CTGAAG 2 cut(s) 36, 273
AfiI CCNNNNNNNGG 1 cut(s) 95
AgsI TTSAA 3 cut(s) 26, 127, 191
AluBI AGCT 7 cut(s) 130, 309, 427, 464, 497, 506, 545
AluI AGCT 7 cut(s) 130, 309, 427, 464, 497, 506, 545
AoxI GGCC 1 cut(s) 331
ApeKI GCWGC 5 cut(s) 79, 424, 461, 503, 545
ApoI RAATTY 2 cut(s) 201, 353
AspLEI GCGC 1 cut(s) 625
AspS9I GGNCC 2 cut(s) 293, 332
AsuHPI GGTGA 2 cut(s) 179, 251
AvaII GGWCC 1 cut(s) 293
BbvI GCAGC 5 cut(s) 66, 436, 473, 515, 532
BccI CCATC 3 cut(s) 436, 481, 613
BfaI CTAG 1 cut(s) 498
BfmI CTRYAG 1 cut(s) 459
BglII AGATCT 1 cut(s) 261
BisI GCNGC 5 cut(s) 80, 425, 462, 504, 546
BlpI GCTNAGC 1 cut(s) 465
BlsI GCNGC 5 cut(s) 81, 426, 463, 505, 547
Bme18I GGWCC 1 cut(s) 293
BmgT120I GGNCC 2 cut(s) 293, 332
BmsI GCATC 1 cut(s) 358
BpmI CTGGAG 1 cut(s) 117
Bpu10I CCTNAGC 1 cut(s) 322
Bpu1102I GCTNAGC 1 cut(s) 465
BpuEI CTTGAG 1 cut(s) 357
BsaAI YACGTR 1 cut(s) 317
Bsc4I CCNNNNNNNGG 1 cut(s) 95
Bse1I ACTGG 1 cut(s) 100
Bse3DI GCAATG 1 cut(s) 426
BseGI GGATG 1 cut(s) 37
BseLI CCNNNNNNNGG 1 cut(s) 95
BseMI GCAATG 1 cut(s) 426
BseMII CTCAG 1 cut(s) 479
BseNI ACTGG 1 cut(s) 100
BseRI GAGGAG 1 cut(s) 491
BseXI GCAGC 5 cut(s) 66, 436, 473, 515, 532
BsgI GTGCAG 1 cut(s) 522
BshFI GGCC 1 cut(s) 333
BslI CCNNNNNNNGG 1 cut(s) 95
BsmI GAATGC 1 cut(s) 187
BsnI GGCC 1 cut(s) 333
Bsp143I GATC 3 cut(s) 67, 261, 302
Bsp1720I GCTNAGC 1 cut(s) 465
BspACI CCGC 1 cut(s) 407
BspANI GGCC 1 cut(s) 333
BspCNI CTCAG 1 cut(s) 478
BspMAI CTGCAG 1 cut(s) 463
BspQI GCTCTTC 1 cut(s) 409
BsrDI GCAATG 1 cut(s) 426
BsrI ACTGG 1 cut(s) 100
BssMI GATC 3 cut(s) 67, 261, 302
Bst4CI ACNGT 1 cut(s) 143
Bst6I CTCTTC 5 cut(s) 21, 186, 409, 513, 555
BstAPI GCANNNNNTGC 2 cut(s) 182, 368
BstBAI YACGTR 1 cut(s) 317
BstC8I GCNNGC 2 cut(s) 331, 429
BstDEI CTNAG 2 cut(s) 322, 465
BstF5I GGATG 1 cut(s) 37
BstHHI GCGC 1 cut(s) 625
BstKTI GATC 3 cut(s) 70, 264, 305
BstMBI GATC 3 cut(s) 67, 261, 302
BstMWI GCNNNNNNNGC 5 cut(s) 182, 368, 404, 503, 578
BstSFI CTRYAG 1 cut(s) 459
BstV1I GCAGC 5 cut(s) 66, 436, 473, 515, 532
BstX2I RGATCY 1 cut(s) 261
BstYI RGATCY 1 cut(s) 261
BsuRI GGCC 1 cut(s) 333
BtsCI GGATG 1 cut(s) 37
BtsI GCAGTG 1 cut(s) 537
BtsIMutI CAGTG 2 cut(s) 148, 537
Cac8I GCNNGC 2 cut(s) 331, 429
CfoI GCGC 1 cut(s) 625
Cfr13I GGNCC 2 cut(s) 293, 332
CviAII CATG 1 cut(s) 159
DdeI CTNAG 2 cut(s) 322, 465
DpnI GATC 3 cut(s) 69, 263, 304
DpnII GATC 3 cut(s) 67, 261, 302
Eam1104I CTCTTC 5 cut(s) 21, 186, 409, 513, 555
EarI CTCTTC 5 cut(s) 21, 186, 409, 513, 555
Eco47I GGWCC 1 cut(s) 293
Eco57I CTGAAG 2 cut(s) 36, 273
FaeI CATG 1 cut(s) 162
FaiI YATR 4 cut(s) 160, 267, 312, 314
FatI CATG 1 cut(s) 158
FblI GTMKAC 1 cut(s) 455
Fnu4HI GCNGC 5 cut(s) 80, 425, 462, 504, 546
FokI GGATG 1 cut(s) 44
Fsp4HI GCNGC 5 cut(s) 80, 425, 462, 504, 546
FspBI CTAG 1 cut(s) 498
GlaI GCGC 1 cut(s) 624
GluI GCNGC 5 cut(s) 80, 425, 462, 504, 546
GsuI CTGGAG 1 cut(s) 117
HaeIII GGCC 1 cut(s) 333
HhaI GCGC 1 cut(s) 625
Hin1II CATG 1 cut(s) 162
Hin6I GCGC 1 cut(s) 623
HinP1I GCGC 1 cut(s) 623
HinfI GANTC 2 cut(s) 7, 388
HphI GGTGA 2 cut(s) 179, 251
Hpy166II GTNNAC 2 cut(s) 296, 456
Hpy188I TCNGA 2 cut(s) 253, 594
Hpy188III TCNNGA 1 cut(s) 89
Hpy8I GTNNAC 2 cut(s) 296, 456
HpyAV CCTTC 1 cut(s) 529
HpyCH4III ACNGT 1 cut(s) 143
HpyCH4IV ACGT 1 cut(s) 316
HpyCH4V TGCA 7 cut(s) 53, 158, 362, 424, 431, 461, 503
HpyF10VI GCNNNNNNNGC 5 cut(s) 182, 368, 404, 503, 578
HpyF3I CTNAG 2 cut(s) 322, 465
HpySE526I ACGT 1 cut(s) 316
Hsp92II CATG 1 cut(s) 162
HspAI GCGC 1 cut(s) 623
Kzo9I GATC 3 cut(s) 67, 261, 302
LguI GCTCTTC 1 cut(s) 409
LmnI GCTCC 1 cut(s) 326
LpnPI CCDG 5 cut(s) 27, 81, 102, 222, 315
Lsp1109I GCAGC 5 cut(s) 66, 436, 473, 515, 532
LweI GCATC 1 cut(s) 358
MaeI CTAG 1 cut(s) 498
MaeII ACGT 1 cut(s) 316
MalI GATC 3 cut(s) 69, 263, 304
MboI GATC 3 cut(s) 67, 261, 302
MboII GAAGA 7 cut(s) 29, 38, 203, 266, 426, 530, 572
MflI RGATCY 1 cut(s) 261
MluCI AATT 6 cut(s) 48, 105, 201, 285, 353, 437
MmeI TCCRAC 1 cut(s) 546
MnlI CCTC 8 cut(s) 22, 94, 372, 376, 469, 520, 562, 643
MseI TTAA 2 cut(s) 47, 575
MspA1I CMGCKG 1 cut(s) 506
Mva1269I GAATGC 1 cut(s) 187
MwoI GCNNNNNNNGC 5 cut(s) 182, 368, 404, 503, 578
NdeII GATC 3 cut(s) 67, 261, 302
NlaIII CATG 1 cut(s) 162
PciSI GCTCTTC 1 cut(s) 409
PctI GAATGC 1 cut(s) 187
PfeI GAWTC 2 cut(s) 7, 388
PkrI GCNGC 5 cut(s) 81, 426, 463, 505, 547
Ppu21I YACGTR 1 cut(s) 317
PspPI GGNCC 2 cut(s) 293, 332
PstI CTGCAG 1 cut(s) 463
PsuI RGATCY 1 cut(s) 261
PvuII CAGCTG 1 cut(s) 506
SapI GCTCTTC 1 cut(s) 409
SaqAI TTAA 2 cut(s) 47, 575
SatI GCNGC 5 cut(s) 80, 425, 462, 504, 546
Sau3AI GATC 3 cut(s) 67, 261, 302
Sau96I GGNCC 2 cut(s) 293, 332
SfaNI GCATC 1 cut(s) 358
SfcI CTRYAG 1 cut(s) 459
SinI GGWCC 1 cut(s) 293
SmlI CTYRAG 1 cut(s) 372
SmoI CTYRAG 1 cut(s) 372
Sse9I AATT 6 cut(s) 48, 105, 201, 285, 353, 437
SsiI CCGC 1 cut(s) 407
SspMI CTAG 1 cut(s) 498
TaaI ACNGT 1 cut(s) 143
TaiI ACGT 1 cut(s) 319
TasI AATT 6 cut(s) 48, 105, 201, 285, 353, 437
TfiI GAWTC 2 cut(s) 7, 388
Tru1I TTAA 2 cut(s) 47, 575
Tru9I TTAA 2 cut(s) 47, 575
TscAI CASTG 2 cut(s) 148, 537
TseI GCWGC 5 cut(s) 79, 424, 461, 503, 545
TspDTI ATGAA 8 cut(s) 212, 239, 243, 285, 417, 450, 531, 573
TspRI CASTG 2 cut(s) 148, 537
VpaK11BI GGWCC 1 cut(s) 293
XapI RAATTY 2 cut(s) 201, 353
XmiI GTMKAC 1 cut(s) 455
XspI CTAG 1 cut(s) 498
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.