Rmu_sc0001909.1_g000015

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001909.1
Physical Location & Seq
Forward (+)
62658 .. 63014
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001909.1_g000015.1.cds

Sequence Viewer

Length: 357 bp
atgtctgatgatgagatatatgataaagttctttccacaattgttggtccacctcggtcaggctacatacgtggcttaggagcaggtcctaagcctaaaaattcgaaagtctccaataatcattcacaacttcaggaggctaaaaggagggcagatgaggcagaaagacgatctacccaacttgtagaggagttagaggcaatgaaggttagtgcagctcaacaaaatgaagaattagaggcagtgaaggctagtgcagctcaacaaagtgaagagttagaggcagttaaagcaaagaaaaacgagacggacgcacttttaaaaaaattgctggaacaattttcctctaggaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.05

Weight (kDa)

6.62

Isoelectric Point (pI)

54.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000178)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G40087 AT3G30200
fragaria_vesca FvH4_1g23271 FvH4_3g22812 FvH4_3g22813 FvH4_3g31042 FvH4_3g31043 FvH4_7g03653
malus_domestica MD05G1321200.v1.1 MD09G1027200.v1.1 MD15G1434900.v1.1 MD15G1435000.v1.1 MD15G1435100.v1.1
prunus_persica Prupe.1G578800_v2.0.a1 Prupe.1G578800_v2.0.a1 Prupe.1G578800_v2.0.a1 Prupe.2G062700_v2.0.a1 Prupe.5G033400_v2.0.a1 Prupe.7G022900_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1
pyrus_communis pycom03g07600 pycom03g11360 pycom05g02870 pycom111g02130 pycom15g38370 pycom15g38380
rosa_chinensis RchiOBHm_Chr1g0346371 RchiOBHm_Chr4g0402051 RchiOBHm_Chr4g0414991 RchiOBHm_Chr5g0051011 RchiOBHm_Chr5g0051181 RchiOBHm_Chr6g0273071 RchiOBHm_Chr7g0218301 RchiOBHm_Chr7g0241081
rosa_laevigata RLG00000007709 RLG00000008953 RLG00000012400 RLG00000012401 RLG00000013805 RLG00000014199 RLG00000014726 RLG00000017792 RLG00000017793 RLG00000018860 RLG00000020749 RLG00000030708 RLG00000033507
rosa_multiflora Rmu_co8373761.1_g000001 Rmu_sc0000028.1_g000023 Rmu_sc0000235.1_g000040 Rmu_sc0000293.1_g000017 Rmu_sc0000293.1_g000019 Rmu_sc0000651.1_g000012 Rmu_sc0000870.1_g000051 Rmu_sc0001167.1_g000031 Rmu_sc0001373.1_g000039 Rmu_sc0001861.1_g000055 Rmu_sc0001891.1_g000038 Rmu_sc0001909.1_g000015 Rmu_sc0002500.1_g000002 Rmu_sc0002868.1_g000036 Rmu_sc0002868.1_g000038 Rmu_sc0002868.1_g000039 Rmu_sc0003379.1_g000001 Rmu_sc0003778.1_g000005 Rmu_sc0003778.1_g000006 Rmu_sc0010475.1_g000011 Rmu_sc0015271.1_g000002 Rmu_sc0015271.1_g000003 Rmu_sc0017962.1_g000001 Rmu_sc0017962.1_g000003 Rmu_sc0022129.1_g000004 Rmu_sc0025694.1_g000003 Rmu_sc0025694.1_g000004
rosa_roxburghii Rroxscaffold_1G00031640 Rroxscaffold_1G00047620 Rroxscaffold_1G00047630 Rroxscaffold_1G00050560 Rroxscaffold_1G00050570 Rroxscaffold_1G00054800 Rroxscaffold_1G00055890 Rroxscaffold_2G00108230 Rroxscaffold_3G00240860 Rroxscaffold_4G00299670 Rroxscaffold_4G00299680 Rroxscaffold_4G00299690 Rroxscaffold_4G00306320 Rroxscaffold_4G00306340 Rroxscaffold_5G00341060 Rroxscaffold_5G00342000 Rroxscaffold_5G00355660 Rroxscaffold_5G00357170 Rroxscaffold_6G00399490 Rroxscaffold_6G00408400 Rroxscaffold_7G00189260 Rroxscaffold_7G00199620 Rroxscaffold_7G00215470
rosa_rugosa Rorug02G0117600 Rorug02G0117700 Rorug04G0116400 Rorug06G0103200
rosa_samantha Rh1AG062800 Rh1AG073700 Rh1CG091700 Rh1DG077600 Rh1DG077700 Rh1DG077800 Rh1DG117400 Rh1DG146300 Rh2BG193300 Rh2BG193400 Rh2BG265300 Rh2BG413400 Rh3CG365500 Rh4AG315400 Rh4BG323100 Rh4BG323200 Rh4CG071400 Rh4CG142500 Rh4CG203300 Rh4CG338300 Rh4DG079300 Rh4DG079400 Rh4DG217000 Rh4DG217100 Rh4DG217200 Rh4DG217300 Rh5AG128300 Rh5AG239900 Rh5AG465900 Rh5BG348600 Rh5BG387900 Rh5BG388000 Rh5CG181800 Rh5CG181900 Rh5CG271000 Rh5CG271100 Rh5DG127100 Rh5DG138400 Rh5DG168200 Rh5DG168300 Rh5DG361500 Rh5DG460400 Rh6AG045400 Rh6AG058600 Rh6BG275000 Rh6CG089700 Rh6DG182300 Rh6DG182400 Rh6DG207300 Rh6DG207400 Rh7BG374000 Rh7BG390600 Rh7BG390700 Rh7BG390800
rosa_wichuraiana Rw0G018690 Rw1G007320 Rw4G008510 Rw5G011510 Rw5G021830 Rw6G024150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 74
AcsI RAATTY 1 cut(s) 100
AcuI CTGAAG 1 cut(s) 116
AfiI CCNNNNNNNGG 1 cut(s) 59
AluBI AGCT 2 cut(s) 218, 260
AluI AGCT 2 cut(s) 218, 260
Alw26I GTCTC 2 cut(s) 115, 299
ApeKI GCWGC 2 cut(s) 215, 257
ApoI RAATTY 1 cut(s) 100
AspS9I GGNCC 2 cut(s) 47, 86
AsuII TTCGAA 1 cut(s) 104
AvaII GGWCC 2 cut(s) 47, 86
BbvI GCAGC 2 cut(s) 227, 269
BcoDI GTCTC 2 cut(s) 115, 299
BfaI CTAG 2 cut(s) 252, 348
BfuAI ACCTGC 1 cut(s) 74
BisI GCNGC 2 cut(s) 216, 258
BlsI GCNGC 2 cut(s) 217, 259
Bme18I GGWCC 2 cut(s) 47, 86
BmgT120I GGNCC 2 cut(s) 47, 86
Bpu10I CCTNAGC 2 cut(s) 76, 90
Bpu14I TTCGAA 1 cut(s) 104
BsaAI YACGTR 1 cut(s) 71
BsaJI CCNNGG 1 cut(s) 53
Bsc4I CCNNNNNNNGG 1 cut(s) 59
Bse3DI GCAATG 1 cut(s) 207
BseDI CCNNGG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 59
BseMI GCAATG 1 cut(s) 207
BseRI GAGGAG 1 cut(s) 203
BseXI GCAGC 2 cut(s) 227, 269
BsgI GTGCAG 2 cut(s) 234, 276
BslI CCNNNNNNNGG 1 cut(s) 59
BsmAI GTCTC 2 cut(s) 115, 299
BsmBI CGTCTC 1 cut(s) 299
Bsp119I TTCGAA 1 cut(s) 104
Bsp143I GATC 1 cut(s) 170
BspMI ACCTGC 1 cut(s) 74
BspT104I TTCGAA 1 cut(s) 104
BsrDI GCAATG 1 cut(s) 207
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 1 cut(s) 170
Bst6I CTCTTC 1 cut(s) 267
BstBAI YACGTR 1 cut(s) 71
BstBI TTCGAA 1 cut(s) 104
BstDEI CTNAG 2 cut(s) 76, 90
BstENI CCTNNNNNAGG 1 cut(s) 57
BstKTI GATC 1 cut(s) 173
BstMAI GTCTC 2 cut(s) 115, 299
BstMBI GATC 1 cut(s) 170
BstMWI GCNNNNNNNGC 4 cut(s) 158, 248, 257, 290
BstV1I GCAGC 2 cut(s) 227, 269
BtsI GCAGTG 1 cut(s) 249
BtsIMutI CAGTG 1 cut(s) 249
BveI ACCTGC 1 cut(s) 74
Cfr13I GGNCC 2 cut(s) 47, 86
CseI GACGC 1 cut(s) 320
CspCI CAANNNNNGTGG 2 cut(s) 25, 60
CviJI RGCY 7 cut(s) 63, 75, 94, 140, 218, 251, 260
CviKI_1 RGCY 7 cut(s) 63, 75, 94, 140, 218, 251, 260
DdeI CTNAG 2 cut(s) 76, 90
DpnI GATC 1 cut(s) 172
DpnII GATC 1 cut(s) 170
DraI TTTAAA 1 cut(s) 321
Eam1104I CTCTTC 1 cut(s) 267
EarI CTCTTC 1 cut(s) 267
Eco47I GGWCC 2 cut(s) 47, 86
Eco57I CTGAAG 1 cut(s) 116
EcoNI CCTNNNNNAGG 1 cut(s) 57
EcoO109I RGGNCCY 1 cut(s) 86
Esp3I CGTCTC 1 cut(s) 299
FaiI YATR 3 cut(s) 19, 21, 68
Fnu4HI GCNGC 2 cut(s) 216, 258
Fsp4HI GCNGC 2 cut(s) 216, 258
FspBI CTAG 2 cut(s) 252, 348
GluI GCNGC 2 cut(s) 216, 258
HgaI GACGC 1 cut(s) 320
Hpy166II GTNNAC 1 cut(s) 50
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 134
Hpy8I GTNNAC 1 cut(s) 50
HpyAV CCTTC 2 cut(s) 199, 241
HpyCH4IV ACGT 1 cut(s) 70
HpyCH4V TGCA 2 cut(s) 215, 257
HpyF10VI GCNNNNNNNGC 4 cut(s) 158, 248, 257, 290
HpyF3I CTNAG 2 cut(s) 76, 90
HpySE526I ACGT 1 cut(s) 70
Kzo9I GATC 1 cut(s) 170
LmnI GCTCC 1 cut(s) 80
LpnPI CCDG 4 cut(s) 45, 69, 119, 317
Lsp1109I GCAGC 2 cut(s) 227, 269
MaeI CTAG 2 cut(s) 252, 348
MaeII ACGT 1 cut(s) 70
MalI GATC 1 cut(s) 172
MboI GATC 1 cut(s) 170
MboII GAAGA 2 cut(s) 242, 284
MfeI CAATTG 1 cut(s) 39
MluCI AATT 5 cut(s) 39, 100, 233, 326, 338
MnlI CCTC 9 cut(s) 63, 130, 141, 151, 181, 190, 232, 274, 355
MseI TTAA 2 cut(s) 288, 320
MunI CAATTG 1 cut(s) 39
MwoI GCNNNNNNNGC 4 cut(s) 158, 248, 257, 290
NdeII GATC 1 cut(s) 170
NspV TTCGAA 1 cut(s) 104
PkrI GCNGC 2 cut(s) 217, 259
Ppu21I YACGTR 1 cut(s) 71
PpuMI RGGWCCY 1 cut(s) 86
Psp5II RGGWCCY 1 cut(s) 86
PspPI GGNCC 2 cut(s) 47, 86
PspPPI RGGWCCY 1 cut(s) 86
SaqAI TTAA 2 cut(s) 288, 320
SatI GCNGC 2 cut(s) 216, 258
Sau3AI GATC 1 cut(s) 170
Sau96I GGNCC 2 cut(s) 47, 86
SetI ASST 6 cut(s) 55, 73, 88, 210, 220, 262
SfuI TTCGAA 1 cut(s) 104
SgeI CNNG 9 cut(s) 66, 72, 83, 96, 146, 194, 264, 316, 344
SinI GGWCC 2 cut(s) 47, 86
Sse9I AATT 5 cut(s) 39, 100, 233, 326, 338
SspMI CTAG 2 cut(s) 252, 348
TaiI ACGT 1 cut(s) 73
TaqI TCGA 1 cut(s) 104
TaqII GACCGA 1 cut(s) 45
TasI AATT 5 cut(s) 39, 100, 233, 326, 338
Tru1I TTAA 2 cut(s) 288, 320
Tru9I TTAA 2 cut(s) 288, 320
TscAI CASTG 1 cut(s) 249
TseI GCWGC 2 cut(s) 215, 257
TspDTI ATGAA 2 cut(s) 218, 243
TspGWI ACGGA 1 cut(s) 323
TspRI CASTG 1 cut(s) 249
VpaK11BI GGWCC 2 cut(s) 47, 86
XagI CCTNNNNNAGG 1 cut(s) 57
XapI RAATTY 1 cut(s) 100
XspI CTAG 2 cut(s) 252, 348
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.