Rmu_sc0015271.1_g000003

Plant transposase (Ptta/En/Spm family)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015271.1
OG0000178
Physical Location & Seq
Forward (+)
10818 .. 13734
2917 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015271.1_g000003.1.cds

Sequence Viewer

Length: 1305 bp
atggccaagagatcacaaggtcctaaatttttgcatcaattgcgaacatcagcacttccaccaaaccacttgcgaatatctgttgaaaaggtttctaggcttgtaaagcctttagataaacctacaacacctgcatgtccattgcgatcatcaactgaaaaggtttctaaggttataaagcctttagttaaacctacagcactttcaagcccattacggttatctcctagaaagcattcaaagacacagccttccacaaatcgatcaatacatcctcgtcgacctgctatccaatcatcaagaactccatctcctccttccccatatgttatgagatcatctccgctttccccttcacctccacatatgcgcacagtcttatcaacctctaatcagcacacatcaactccaagtgcacacgaagagatagctgaatcttctcaagttgctcatcctcctaccttagtagagaacattggtggtcttgggacagccaagaagaaacgacctagtaatcaaatagagattgatattccagagcatgtaaaacgagccgtaggagagaattgccagtcttacatcacagagataggctgcattgttaggcaaaatgctccattacaagttaagcattggagtggaattaatagggatgatgttgctacgatggttcgtcttgtccgtgagaaattcaaattggggaatgaaccacatgtgaatgaggctattgaggcagacatgaaaagaagatatagcacttggcgatacaatttgcataagatgtttttgcaatatgaatcagcggaggaggcacttgagaatagacctgaaaatgtgggagaagatgactgggattttctcatcaattggtggcacgatgatgagtggctgggtgagatgacaaaactaagaaatcctgagcaaacagatgaagggtcagaaaaagtaatgtctgatgatgagatatatgataaagttctttccacaattgttggtccacctcggtcaggctacatacgtggcttaggagcaggtcctaagcctaaaaattcgaaagtctccaataatcattcacaacttcaggaggctaaaaggagggcagatgaggcagaaagacgatctacccaacttgtagaggagttagaggcaatgaaggttagtgcagctcaacaaaatgaagaattagaggcagtgaaggctagtgcagctcaacaaagtgaagagttagaggcagttaaagcaaagcaaaatgagacggacgcaattttaaaaaaattgctggaacaattttcctctaggaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Transposase_24

Protein Analysis

434

Amino Acids

48.86

Weight (kDa)

9.24

Isoelectric Point (pI)

63.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000178)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G40087 AT3G30200
fragaria_vesca FvH4_1g23271 FvH4_3g22812 FvH4_3g22813 FvH4_3g31042 FvH4_3g31043 FvH4_7g03653
malus_domestica MD05G1321200.v1.1 MD09G1027200.v1.1 MD15G1434900.v1.1 MD15G1435000.v1.1 MD15G1435100.v1.1
prunus_persica Prupe.1G578800_v2.0.a1 Prupe.1G578800_v2.0.a1 Prupe.1G578800_v2.0.a1 Prupe.2G062700_v2.0.a1 Prupe.5G033400_v2.0.a1 Prupe.7G022900_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1 Prupe.7G105300_v2.0.a1
pyrus_communis pycom03g07600 pycom03g11360 pycom05g02870 pycom111g02130 pycom15g38370 pycom15g38380
rosa_chinensis RchiOBHm_Chr1g0346371 RchiOBHm_Chr4g0402051 RchiOBHm_Chr4g0414991 RchiOBHm_Chr5g0051011 RchiOBHm_Chr5g0051181 RchiOBHm_Chr6g0273071 RchiOBHm_Chr7g0218301 RchiOBHm_Chr7g0241081
rosa_laevigata RLG00000007709 RLG00000008953 RLG00000012400 RLG00000012401 RLG00000013805 RLG00000014199 RLG00000014726 RLG00000017792 RLG00000017793 RLG00000018860 RLG00000020749 RLG00000030708 RLG00000033507
rosa_multiflora Rmu_co8373761.1_g000001 Rmu_sc0000028.1_g000023 Rmu_sc0000235.1_g000040 Rmu_sc0000293.1_g000017 Rmu_sc0000293.1_g000019 Rmu_sc0000651.1_g000012 Rmu_sc0000870.1_g000051 Rmu_sc0001167.1_g000031 Rmu_sc0001373.1_g000039 Rmu_sc0001861.1_g000055 Rmu_sc0001891.1_g000038 Rmu_sc0001909.1_g000015 Rmu_sc0002500.1_g000002 Rmu_sc0002868.1_g000036 Rmu_sc0002868.1_g000038 Rmu_sc0002868.1_g000039 Rmu_sc0003379.1_g000001 Rmu_sc0003778.1_g000005 Rmu_sc0003778.1_g000006 Rmu_sc0010475.1_g000011 Rmu_sc0015271.1_g000002 Rmu_sc0015271.1_g000003 Rmu_sc0017962.1_g000001 Rmu_sc0017962.1_g000003 Rmu_sc0022129.1_g000004 Rmu_sc0025694.1_g000003 Rmu_sc0025694.1_g000004
rosa_roxburghii Rroxscaffold_1G00031640 Rroxscaffold_1G00047620 Rroxscaffold_1G00047630 Rroxscaffold_1G00050560 Rroxscaffold_1G00050570 Rroxscaffold_1G00054800 Rroxscaffold_1G00055890 Rroxscaffold_2G00108230 Rroxscaffold_3G00240860 Rroxscaffold_4G00299670 Rroxscaffold_4G00299680 Rroxscaffold_4G00299690 Rroxscaffold_4G00306320 Rroxscaffold_4G00306340 Rroxscaffold_5G00341060 Rroxscaffold_5G00342000 Rroxscaffold_5G00355660 Rroxscaffold_5G00357170 Rroxscaffold_6G00399490 Rroxscaffold_6G00408400 Rroxscaffold_7G00189260 Rroxscaffold_7G00199620 Rroxscaffold_7G00215470
rosa_rugosa Rorug02G0117600 Rorug02G0117700 Rorug04G0116400 Rorug06G0103200
rosa_samantha Rh1AG062800 Rh1AG073700 Rh1CG091700 Rh1DG077600 Rh1DG077700 Rh1DG077800 Rh1DG117400 Rh1DG146300 Rh2BG193300 Rh2BG193400 Rh2BG265300 Rh2BG413400 Rh3CG365500 Rh4AG315400 Rh4BG323100 Rh4BG323200 Rh4CG071400 Rh4CG142500 Rh4CG203300 Rh4CG338300 Rh4DG079300 Rh4DG079400 Rh4DG217000 Rh4DG217100 Rh4DG217200 Rh4DG217300 Rh5AG128300 Rh5AG239900 Rh5AG465900 Rh5BG348600 Rh5BG387900 Rh5BG388000 Rh5CG181800 Rh5CG181900 Rh5CG271000 Rh5CG271100 Rh5DG127100 Rh5DG138400 Rh5DG168200 Rh5DG168300 Rh5DG361500 Rh5DG460400 Rh6AG045400 Rh6AG058600 Rh6BG275000 Rh6CG089700 Rh6DG182300 Rh6DG182400 Rh6DG207300 Rh6DG207400 Rh7BG374000 Rh7BG390600 Rh7BG390700 Rh7BG390800
rosa_wichuraiana Rw0G018690 Rw1G007320 Rw4G008510 Rw5G011510 Rw5G021830 Rw6G024150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 176
AarI CACCTGC 1 cut(s) 139
Acc16I TGCGCA 1 cut(s) 371
Acc36I ACCTGC 3 cut(s) 139, 292, 1022
AccI GTMKAC 1 cut(s) 280
AciI CCGC 2 cut(s) 344, 803
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 3 cut(s) 26, 689, 1048
AcuI CTGAAG 1 cut(s) 1064
AfiI CCNNNNNNNGG 1 cut(s) 1007
AflIII ACRYGT 1 cut(s) 712
AgsI TTSAA 4 cut(s) 86, 207, 240, 694
AjuI GAANNNNNNNTTGG 2 cut(s) 680, 712
AloI GAACNNNNNNTCC 2 cut(s) 295, 327
AluBI AGCT 3 cut(s) 431, 1166, 1208
AluI AGCT 3 cut(s) 431, 1166, 1208
Alw21I GWGCWC 1 cut(s) 418
Alw26I GTCTC 2 cut(s) 1063, 1247
Alw44I GTGCAC 1 cut(s) 414
AoxI GGCC 1 cut(s) 3
ApaLI GTGCAC 1 cut(s) 414
ApeKI GCWGC 3 cut(s) 594, 1163, 1205
ApoI RAATTY 3 cut(s) 26, 689, 1048
AseI ATTAAT 1 cut(s) 645
Asp700I GAANNNNTTC 1 cut(s) 235
AspLEI GCGC 1 cut(s) 372
AspS9I GGNCC 3 cut(s) 20, 995, 1034
AsuHPI GGTGA 2 cut(s) 348, 905
AsuII TTCGAA 1 cut(s) 1052
AvaII GGWCC 3 cut(s) 20, 995, 1034
BaeGI GKGCMC 1 cut(s) 418
BalI TGGCCA 1 cut(s) 5
Bbv12I GWGCWC 1 cut(s) 418
BbvI GCAGC 3 cut(s) 581, 1175, 1217
BccI CCATC 2 cut(s) 316, 661
BceAI ACGGC 1 cut(s) 539
BcoDI GTCTC 2 cut(s) 1063, 1247
BfaI CTAG 5 cut(s) 96, 228, 510, 1200, 1296
BfmI CTRYAG 1 cut(s) 195
BfuAI ACCTGC 3 cut(s) 139, 292, 1022
BisI GCNGC 3 cut(s) 595, 1164, 1206
BlsI GCNGC 3 cut(s) 596, 1165, 1207
Bme18I GGWCC 3 cut(s) 20, 995, 1034
BmgT120I GGNCC 3 cut(s) 20, 995, 1034
BmrI ACTGGG 1 cut(s) 859
BmsI GCATC 1 cut(s) 43
BmuI ACTGGG 1 cut(s) 859
BplI GAGNNNNNCTC 2 cut(s) 325, 357
Bpu10I CCTNAGC 3 cut(s) 918, 1024, 1038
Bpu14I TTCGAA 1 cut(s) 1052
BpuEI CTTGAG 2 cut(s) 426, 836
Bsa29I ATCGAT 1 cut(s) 262
BsaAI YACGTR 1 cut(s) 1019
BsaJI CCNNGG 1 cut(s) 1001
BsaXI ACNNNNNCTCC 4 cut(s) 295, 325, 391, 421
Bsc4I CCNNNNNNNGG 1 cut(s) 1007
Bse1I ACTGG 2 cut(s) 571, 854
Bse3DI GCAATG 2 cut(s) 140, 1155
BseCI ATCGAT 1 cut(s) 262
BseDI CCNNGG 1 cut(s) 1001
BseGI GGATG 3 cut(s) 271, 451, 658
BseLI CCNNNNNNNGG 1 cut(s) 1007
BseMI GCAATG 2 cut(s) 140, 1155
BseMII CTCAG 1 cut(s) 909
BseNI ACTGG 2 cut(s) 571, 854
BseRI GAGGAG 3 cut(s) 303, 821, 1151
BseSI GKGCMC 1 cut(s) 418
BseXI GCAGC 3 cut(s) 581, 1175, 1217
BseYI CCCAGC 1 cut(s) 889
BsgI GTGCAG 2 cut(s) 1182, 1224
BshFI GGCC 1 cut(s) 5
BshVI ATCGAT 1 cut(s) 262
BsiHKAI GWGCWC 1 cut(s) 418
BslFI GGGAC 1 cut(s) 502
BslI CCNNNNNNNGG 1 cut(s) 1007
BsmAI GTCTC 2 cut(s) 1063, 1247
BsmBI CGTCTC 1 cut(s) 1247
BsmFI GGGAC 1 cut(s) 502
BsmI GAATGC 1 cut(s) 235
BsnI GGCC 1 cut(s) 5
Bsp119I TTCGAA 1 cut(s) 1052
Bsp1286I GDGCHC 1 cut(s) 418
Bsp143I GATC 5 cut(s) 11, 146, 263, 335, 1118
BspACI CCGC 2 cut(s) 344, 803
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 910
BspDI ATCGAT 1 cut(s) 262
BspMI ACCTGC 3 cut(s) 139, 292, 1022
BspT104I TTCGAA 1 cut(s) 1052
BsrDI GCAATG 2 cut(s) 140, 1155
BsrI ACTGG 2 cut(s) 571, 854
BssECI CCNNGG 1 cut(s) 1001
BssMI GATC 5 cut(s) 11, 146, 263, 335, 1118
Bst4CI ACNGT 2 cut(s) 219, 376
Bst6I CTCTTC 2 cut(s) 417, 1215
BstAPI GCANNNNNTGC 1 cut(s) 40
BstBAI YACGTR 1 cut(s) 1019
BstBI TTCGAA 1 cut(s) 1052
BstDEI CTNAG 6 cut(s) 168, 463, 908, 918, 1024, 1038
BstENI CCTNNNNNAGG 1 cut(s) 1005
BstF5I GGATG 3 cut(s) 271, 451, 658
BstHHI GCGC 1 cut(s) 372
BstKTI GATC 5 cut(s) 14, 149, 266, 338, 1121
BstMAI GTCTC 2 cut(s) 1063, 1247
BstMBI GATC 5 cut(s) 11, 146, 263, 335, 1118
BstMWI GCNNNNNNNGC 8 cut(s) 40, 106, 731, 809, 1106, 1196, 1205, 1238
BstNSI RCATGY 3 cut(s) 138, 545, 716
BstSFI CTRYAG 1 cut(s) 195
BstSLI GKGCMC 1 cut(s) 418
BstV1I GCAGC 3 cut(s) 581, 1175, 1217
Bsu15I ATCGAT 1 cut(s) 262
BsuRI GGCC 1 cut(s) 5
BsuTUI ATCGAT 1 cut(s) 262
BtsCI GGATG 3 cut(s) 271, 451, 658
BtsI GCAGTG 1 cut(s) 1197
BtsIMutI CAGTG 1 cut(s) 1197
BveI ACCTGC 3 cut(s) 139, 292, 1022
CfoI GCGC 1 cut(s) 372
Cfr13I GGNCC 3 cut(s) 20, 995, 1034
ClaI ATCGAT 1 cut(s) 262
CseI GACGC 1 cut(s) 1268
CspCI CAANNNNNGTGG 2 cut(s) 973, 1008
CviAII CATG 4 cut(s) 135, 542, 713, 739
DdeI CTNAG 6 cut(s) 168, 463, 908, 918, 1024, 1038
DpnI GATC 5 cut(s) 13, 148, 265, 337, 1120
DpnII GATC 5 cut(s) 11, 146, 263, 335, 1118
DraI TTTAAA 1 cut(s) 1269
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 2 cut(s) 417, 1215
EarI CTCTTC 2 cut(s) 417, 1215
Eco47I GGWCC 3 cut(s) 20, 995, 1034
Eco57I CTGAAG 1 cut(s) 1064
EcoNI CCTNNNNNAGG 1 cut(s) 1005
EcoO109I RGGNCCY 2 cut(s) 20, 1034
Esp3I CGTCTC 1 cut(s) 1247
FaeI CATG 4 cut(s) 138, 545, 716, 742
FaqI GGGAC 1 cut(s) 502
FatI CATG 4 cut(s) 134, 541, 712, 738
FauNDI CATATG 2 cut(s) 325, 366
FblI GTMKAC 1 cut(s) 280
Fnu4HI GCNGC 3 cut(s) 595, 1164, 1206
FokI GGATG 3 cut(s) 258, 438, 665
Fsp4HI GCNGC 3 cut(s) 595, 1164, 1206
FspAI RTGCGCAY 1 cut(s) 371
FspBI CTAG 5 cut(s) 96, 228, 510, 1200, 1296
FspI TGCGCA 1 cut(s) 371
GlaI GCGC 1 cut(s) 371
GluI GCNGC 3 cut(s) 595, 1164, 1206
GsaI CCCAGC 1 cut(s) 893
HaeIII GGCC 1 cut(s) 5
HgaI GACGC 1 cut(s) 1268
HhaI GCGC 1 cut(s) 372
Hin1II CATG 4 cut(s) 138, 545, 716, 742
Hin6I GCGC 1 cut(s) 370
HinP1I GCGC 1 cut(s) 370
HincII GTYRAC 1 cut(s) 281
HindII GTYRAC 1 cut(s) 281
HinfI GANTC 2 cut(s) 434, 797
HphI GGTGA 2 cut(s) 348, 905
Hpy166II GTNNAC 3 cut(s) 281, 416, 998
Hpy188I TCNGA 2 cut(s) 940, 955
Hpy188III TCNNGA 4 cut(s) 300, 536, 917, 1082
Hpy8I GTNNAC 3 cut(s) 281, 416, 998
Hpy99I CGWCG 1 cut(s) 282
HpyAV CCTTC 6 cut(s) 261, 327, 363, 926, 1147, 1189
HpyCH4III ACNGT 2 cut(s) 219, 376
HpyCH4IV ACGT 1 cut(s) 1018
HpyCH4V TGCA 8 cut(s) 34, 134, 416, 597, 775, 790, 1163, 1205
HpyF10VI GCNNNNNNNGC 8 cut(s) 40, 106, 731, 809, 1106, 1196, 1205, 1238
HpyF3I CTNAG 6 cut(s) 168, 463, 908, 918, 1024, 1038
HpySE526I ACGT 1 cut(s) 1018
Hsp92II CATG 4 cut(s) 138, 545, 716, 742
HspAI GCGC 1 cut(s) 370
Kzo9I GATC 5 cut(s) 11, 146, 263, 335, 1118
LmnI GCTCC 2 cut(s) 619, 1028
Lsp1109I GCAGC 3 cut(s) 581, 1175, 1217
LweI GCATC 1 cut(s) 43
MaeI CTAG 5 cut(s) 96, 228, 510, 1200, 1296
MaeII ACGT 1 cut(s) 1018
MalI GATC 5 cut(s) 13, 148, 265, 337, 1120
MboI GATC 5 cut(s) 11, 146, 263, 335, 1118
MboII GAAGA 7 cut(s) 429, 434, 511, 759, 854, 1190, 1232
MfeI CAATTG 3 cut(s) 38, 865, 987
MhlI GDGCHC 1 cut(s) 418
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
Mox20I TGGCCA 1 cut(s) 5
MroXI GAANNNNTTC 1 cut(s) 235
MscI TGGCCA 1 cut(s) 5
MseI TTAA 5 cut(s) 189, 627, 645, 1236, 1268
MslI CAYNNNNRTG 4 cut(s) 133, 636, 717, 879
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 803
MunI CAATTG 3 cut(s) 38, 865, 987
Mva1269I GAATGC 1 cut(s) 235
MwoI GCNNNNNNNGC 8 cut(s) 40, 106, 731, 809, 1106, 1196, 1205, 1238
NdeI CATATG 2 cut(s) 325, 366
NdeII GATC 5 cut(s) 11, 146, 263, 335, 1118
NlaIII CATG 4 cut(s) 138, 545, 716, 742
NsbI TGCGCA 1 cut(s) 371
NspI RCATGY 3 cut(s) 138, 545, 716
NspV TTCGAA 1 cut(s) 1052
PaqCI CACCTGC 1 cut(s) 139
PciI ACATGT 1 cut(s) 712
PcsI WCGNNNNNNNCGW 1 cut(s) 679
PctI GAATGC 1 cut(s) 235
PdmI GAANNNNTTC 1 cut(s) 235
PfeI GAWTC 2 cut(s) 434, 797
PkrI GCNGC 3 cut(s) 596, 1165, 1207
Ppu21I YACGTR 1 cut(s) 1019
PpuMI RGGWCCY 2 cut(s) 20, 1034
PscI ACATGT 1 cut(s) 712
PshBI ATTAAT 1 cut(s) 645
PsiI TTATAA 1 cut(s) 176
Psp5II RGGWCCY 2 cut(s) 20, 1034
PspFI CCCAGC 1 cut(s) 889
PspPI GGNCC 3 cut(s) 20, 995, 1034
PspPPI RGGWCCY 2 cut(s) 20, 1034
RseI CAYNNNNRTG 4 cut(s) 133, 636, 717, 879
SalI GTCGAC 1 cut(s) 279
SaqAI TTAA 5 cut(s) 189, 627, 645, 1236, 1268
SatI GCNGC 3 cut(s) 595, 1164, 1206
Sau3AI GATC 5 cut(s) 11, 146, 263, 335, 1118
Sau96I GGNCC 3 cut(s) 20, 995, 1034
SduI GDGCHC 1 cut(s) 418
SfaNI GCATC 1 cut(s) 43
SfcI CTRYAG 1 cut(s) 195
SfuI TTCGAA 1 cut(s) 1052
SinI GGWCC 3 cut(s) 20, 995, 1034
SmiMI CAYNNNNRTG 4 cut(s) 133, 636, 717, 879
SmlI CTYRAG 2 cut(s) 441, 815
SmoI CTYRAG 2 cut(s) 441, 815
SsiI CCGC 2 cut(s) 344, 803
SspMI CTAG 5 cut(s) 96, 228, 510, 1200, 1296
TaaI ACNGT 2 cut(s) 219, 376
TaiI ACGT 1 cut(s) 1021
TaqI TCGA 3 cut(s) 262, 280, 1052
TaqII GACCGA 1 cut(s) 993
TfiI GAWTC 2 cut(s) 434, 797
Tru1I TTAA 5 cut(s) 189, 627, 645, 1236, 1268
Tru9I TTAA 5 cut(s) 189, 627, 645, 1236, 1268
TscAI CASTG 1 cut(s) 1197
TseI GCWGC 3 cut(s) 594, 1163, 1205
TspDTI ATGAA 6 cut(s) 720, 755, 810, 945, 1166, 1191
TspGWI ACGGA 2 cut(s) 671, 1271
TspRI CASTG 1 cut(s) 1197
VneI GTGCAC 1 cut(s) 414
VpaK11BI GGWCC 3 cut(s) 20, 995, 1034
VspI ATTAAT 1 cut(s) 645
XagI CCTNNNNNAGG 1 cut(s) 1005
XapI RAATTY 3 cut(s) 26, 689, 1048
XceI RCATGY 3 cut(s) 138, 545, 716
XmiI GTMKAC 1 cut(s) 280
XmnI GAANNNNTTC 1 cut(s) 235
XspI CTAG 5 cut(s) 96, 228, 510, 1200, 1296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.