Rmu_sc0008966.1_g000002

f-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008966.1
OG0000424
Physical Location & Seq
Reverse (-)
11004 .. 11924
921 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008966.1_g000002.1.cds

Sequence Viewer

Length: 702 bp
atggctcatgttcctacacctttaacgattcgcagcctgccatctgagattgttgaagacattcttttacggctctcgcccaaagaattgattagatgtttgtgtgttttgaagtcgtggaatgctttaattcgcaacgaacagttctacaaggctcacctcaagaggtctcaggaaaccaaccattaccgaatgcttaaattcaagagaattccctttacacccattgagttggcggctgggactcagaggacacattcgatgtatggttttggatatgatcaatccagtagtgagtataaaattgttagaattgtgggatttgtaaatggtgaaaggggttcggaagtgaagctttacagtctgaaatccaacttatggaagaggattctaagcttccctttcacaaggaattcatctcatttttattcacgtgtcgttcctctaaatggtgctctacattggctcgttacagataattcacattcccagagtgtaagagttgttgctcttgatctctcaaaagaaaccttcaatgagttttccacccagtttactgatgtcgaagacggaattggtttggaggtgttgggaggtagtctctgcatttgtcttaatcattgggaaaccagtaatgaagtctggaaaatgaaagaatatggagtggctgaatcttgggttcatttctatactgtaaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box F-box-like FBA_1

Protein Analysis

233

Amino Acids

26.94

Weight (kDa)

8.99

Isoelectric Point (pI)

47.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000424)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G32600 AT1G54640
fragaria_vesca FvH4_2g26290 FvH4_2g26290 FvH4_2g26300 FvH4_5g16160 FvH4_6g49561 FvH4_6g49581
malus_domestica MD02G1261500.v1.1 MD02G1290400.v1.1 MD02G1290700.v1.1 MD02G1290800.v1.1 MD05G1183700.v1.1 MD07G1058700.v1.1 MD07G1058900.v1.1 MD07G1059200.v1.1 MD08G1079300.v1.1 MD08G1079600.v1.1 MD16G1218300.v1.1 MD16G1218400.v1.1 MD16G1218600.v1.1 MD16G1218700.v1.1 MD17G1102900.v1.1
prunus_persica Prupe.1G024400_v2.0.a1 Prupe.1G024500_v2.0.a1 Prupe.1G024600_v2.0.a1 Prupe.1G024800_v2.0.a1 Prupe.1G025300_v2.0.a1 Prupe.1G025400_v2.0.a1 Prupe.1G556300_v2.0.a1 Prupe.3G094100_v2.0.a1 Prupe.3G094200_v2.0.a1
pyrus_communis pycom02g22350 pycom05g27240 pycom07g04530 pycom07g04540 pycom08g06570 pycom10g07370 pycom16g17130 pycom16g17140 pycom16g17150 pycom16g17160 pycom16g17180 pycom17g09720
rosa_chinensis RchiOBHm_Chr6g0294901 RchiOBHm_Chr7g0179991 RchiOBHm_Chr7g0180101 RchiOBHm_Chr7g0180241
rosa_laevigata RLG00000005281 RLG00000005282 RLG00000005293 RLG00000005304 RLG00000011829 RLG00000011831 RLG00000011832 RLG00000021887
rosa_multiflora Rmu_co8519977.1_g000001 Rmu_sc0008966.1_g000002 Rmu_sc0008966.1_g000003 Rmu_sc0008966.1_g000008 Rmu_sc0011963.1_g000010 Rmu_ssc0000119.1_g000012 Rmu_ssc0000119.1_g000032
rosa_roxburghii Rroxscaffold_2G00081970 Rroxscaffold_2G00081980 Rroxscaffold_3G00273030 Rroxscaffold_3G00273250 Rroxscaffold_7G00172880 Rroxscaffold_7G00172900
rosa_rugosa Rorug02G0541400 Rorug06G0429600
rosa_samantha Rh2AG613800 Rh2CG595200 Rh2CG595300 Rh6AG361300 Rh6BG368000 Rh6BG368100 Rh6BG368300 Rh6BG368500 Rh6BG368600 Rh6CG375200 Rh6CG375300 Rh7AG030100 Rh7AG031000 Rh7AG032000 Rh7BG029400 Rh7BG029500 Rh7BG032100 Rh7CG031100 Rh7CG032700 Rh7CG032800 Rh7CG033900 Rh7DG030400 Rh7DG032400
rosa_wichuraiana Rw7G002420 Rw7G002670

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 378
AciI CCGC 1 cut(s) 236
AcsI RAATTY 3 cut(s) 200, 210, 412
AcvI CACGTG 1 cut(s) 434
AfiI CCNNNNNNNGG 2 cut(s) 378, 449
AflIII ACRYGT 1 cut(s) 433
AgsI TTSAA 4 cut(s) 56, 112, 205, 535
AjuI GAANNNNNNNTTGG 2 cut(s) 558, 590
AluBI AGCT 2 cut(s) 355, 396
AluI AGCT 2 cut(s) 355, 396
Alw21I GWGCWC 1 cut(s) 457
Alw26I GTCTC 2 cut(s) 174, 605
ApeKI GCWGC 1 cut(s) 33
ApoI RAATTY 3 cut(s) 200, 210, 412
Asp700I GAANNNNTTC 1 cut(s) 60
AsuHPI GGTGA 2 cut(s) 149, 344
BbrPI CACGTG 1 cut(s) 434
BbsI GAAGAC 2 cut(s) 63, 573
Bbv12I GWGCWC 1 cut(s) 457
BbvI GCAGC 1 cut(s) 45
BccI CCATC 1 cut(s) 49
BceAI ACGGC 1 cut(s) 86
BclI TGATCA 1 cut(s) 280
BcoDI GTCTC 2 cut(s) 174, 605
BisI GCNGC 2 cut(s) 34, 237
BlsI GCNGC 2 cut(s) 35, 238
BmrI ACTGGG 1 cut(s) 544
BmuI ACTGGG 1 cut(s) 544
BpiI GAAGAC 2 cut(s) 63, 573
BplI GAGNNNNNCTC 2 cut(s) 585, 617
BpuEI CTTGAG 1 cut(s) 146
BsaAI YACGTR 1 cut(s) 434
BsaI GGTCTC 1 cut(s) 174
Bsc4I CCNNNNNNNGG 2 cut(s) 378, 449
Bse1I ACTGG 3 cut(s) 288, 550, 630
BseLI CCNNNNNNNGG 2 cut(s) 378, 449
BseMII CTCAG 3 cut(s) 36, 185, 260
BseNI ACTGG 3 cut(s) 288, 550, 630
BseXI GCAGC 1 cut(s) 45
BseYI CCCAGC 1 cut(s) 239
BsiHKAI GWGCWC 1 cut(s) 457
BslFI GGGAC 1 cut(s) 256
BslI CCNNNNNNNGG 2 cut(s) 378, 449
BsmAI GTCTC 2 cut(s) 174, 605
BsmFI GGGAC 1 cut(s) 256
BsmI GAATGC 2 cut(s) 127, 198
Bso31I GGTCTC 1 cut(s) 174
Bsp1286I GDGCHC 1 cut(s) 457
Bsp143I GATC 2 cut(s) 280, 514
BspACI CCGC 1 cut(s) 236
BspCNI CTCAG 3 cut(s) 37, 184, 259
BspTNI GGTCTC 1 cut(s) 174
BsrI ACTGG 3 cut(s) 288, 550, 630
BssMI GATC 2 cut(s) 280, 514
Bst4CI ACNGT 3 cut(s) 144, 362, 694
Bst6I CTCTTC 1 cut(s) 377
BstBAI YACGTR 1 cut(s) 434
BstC8I GCNNGC 1 cut(s) 38
BstDEI CTNAG 4 cut(s) 45, 171, 246, 392
BstKTI GATC 2 cut(s) 283, 517
BstMAI GTCTC 2 cut(s) 174, 605
BstMBI GATC 2 cut(s) 280, 514
BstV1I GCAGC 1 cut(s) 45
BstV2I GAAGAC 2 cut(s) 63, 573
BstXI CCANNNNNNTGG 1 cut(s) 232
Cac8I GCNNGC 1 cut(s) 38
CviAII CATG 1 cut(s) 8
CviJI RGCY 9 cut(s) 5, 36, 73, 155, 239, 355, 396, 466, 668
CviKI_1 RGCY 9 cut(s) 5, 36, 73, 155, 239, 355, 396, 466, 668
DdeI CTNAG 4 cut(s) 45, 171, 246, 392
DpnI GATC 2 cut(s) 282, 516
DpnII GATC 2 cut(s) 280, 514
Eam1104I CTCTTC 1 cut(s) 377
EarI CTCTTC 1 cut(s) 377
Eco31I GGTCTC 1 cut(s) 174
Eco72I CACGTG 1 cut(s) 434
EcoRI GAATTC 2 cut(s) 210, 412
FaeI CATG 1 cut(s) 11
FaiI YATR 7 cut(s) 9, 267, 279, 300, 379, 660, 690
FalI AAGNNNNNCTT 6 cut(s) 48, 80, 339, 371, 385, 417
FaqI GGGAC 1 cut(s) 256
FatI CATG 1 cut(s) 7
FbaI TGATCA 1 cut(s) 280
Fnu4HI GCNGC 2 cut(s) 34, 237
Fsp4HI GCNGC 2 cut(s) 34, 237
GluI GCNGC 2 cut(s) 34, 237
GsaI CCCAGC 1 cut(s) 243
Hin1II CATG 1 cut(s) 11
HindIII AAGCTT 2 cut(s) 353, 394
HinfI GANTC 4 cut(s) 28, 244, 388, 671
HphI GGTGA 2 cut(s) 149, 344
Hpy166II GTNNAC 1 cut(s) 555
Hpy188I TCNGA 4 cut(s) 46, 249, 346, 366
Hpy188III TCNNGA 5 cut(s) 163, 173, 205, 512, 643
Hpy8I GTNNAC 1 cut(s) 555
HpyAV CCTTC 1 cut(s) 541
HpyCH4III ACNGT 3 cut(s) 144, 362, 694
HpyCH4IV ACGT 1 cut(s) 433
HpyCH4V TGCA 1 cut(s) 606
HpyF3I CTNAG 4 cut(s) 45, 171, 246, 392
HpySE526I ACGT 1 cut(s) 433
Hsp92II CATG 1 cut(s) 11
Ksp22I TGATCA 1 cut(s) 280
Kzo9I GATC 2 cut(s) 280, 514
LpnPI CCDG 8 cut(s) 50, 158, 225, 301, 503, 563, 628, 643
Lsp1109I GCAGC 1 cut(s) 45
MaeII ACGT 1 cut(s) 433
MaeIII GTNAC 1 cut(s) 469
MalI GATC 2 cut(s) 282, 516
MboI GATC 2 cut(s) 280, 514
MboII GAAGA 3 cut(s) 68, 394, 578
MhlI GDGCHC 1 cut(s) 457
MluCI AATT 9 cut(s) 86, 129, 200, 210, 303, 312, 412, 478, 573
MlyI GAGTC 1 cut(s) 238
MmeI TCCRAC 1 cut(s) 396
MnlI CCTC 7 cut(s) 159, 170, 243, 378, 453, 577, 587
MroXI GAANNNNTTC 1 cut(s) 60
MseI TTAA 4 cut(s) 23, 128, 198, 615
Mva1269I GAATGC 2 cut(s) 127, 198
NdeII GATC 2 cut(s) 280, 514
NlaIII CATG 1 cut(s) 11
PctI GAATGC 2 cut(s) 127, 198
PdmI GAANNNNTTC 1 cut(s) 60
PfeI GAWTC 3 cut(s) 28, 388, 671
PflMI CCANNNNNTGG 1 cut(s) 378
PkrI GCNGC 2 cut(s) 35, 238
PleI GAGTC 1 cut(s) 238
PmaCI CACGTG 1 cut(s) 434
PmlI CACGTG 1 cut(s) 434
PpsI GAGTC 1 cut(s) 238
Ppu21I YACGTR 1 cut(s) 434
PspCI CACGTG 1 cut(s) 434
PspFI CCCAGC 1 cut(s) 239
SaqAI TTAA 4 cut(s) 23, 128, 198, 615
SatI GCNGC 2 cut(s) 34, 237
Sau3AI GATC 2 cut(s) 280, 514
SchI GAGTC 1 cut(s) 238
SduI GDGCHC 1 cut(s) 457
SetI ASST 9 cut(s) 22, 162, 170, 357, 398, 436, 533, 588, 598
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
Sse9I AATT 9 cut(s) 86, 129, 200, 210, 303, 312, 412, 478, 573
SsiI CCGC 1 cut(s) 236
TaaI ACNGT 3 cut(s) 144, 362, 694
TaiI ACGT 1 cut(s) 436
TaqI TCGA 2 cut(s) 260, 564
TasI AATT 9 cut(s) 86, 129, 200, 210, 303, 312, 412, 478, 573
TauI GCSGC 1 cut(s) 239
TfiI GAWTC 3 cut(s) 28, 388, 671
Tru1I TTAA 4 cut(s) 23, 128, 198, 615
Tru9I TTAA 4 cut(s) 23, 128, 198, 615
TseI GCWGC 1 cut(s) 33
TspDTI ATGAA 4 cut(s) 405, 651, 665, 671
TspGWI ACGGA 1 cut(s) 585
Van91I CCANNNNNTGG 1 cut(s) 378
XapI RAATTY 3 cut(s) 200, 210, 412
XmnI GAANNNNTTC 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.