Rmu_sc0025597.1_g000001

2-alkenal reductase (NADP( )-dependent)-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0025597.1
Physical Location & Seq
Forward (+)
77 .. 750
674 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0025597.1_g000001.1.cds

Sequence Viewer

Length: 396 bp
atggctagtcgagaagaagtgaagaacaagcaggtgatattcgaagactatatcaccggcttccccaaagaatccgacctcaaattgaccactgccactaccaaactcaagcttccagaaggttcgactggcctcctcgtcaagaacctctacttgtcctgcgacccttacatgcgaagccgtatgaccaagcacgacaggcccacttatgtccaatccttcacgcccggctcgcctgtgactggtttgggagtggctaaagtcctggaatccggggatacaaagtttaagccaggggacttggtttggggtcagactggttgggaagaatatagtgtcatcaccacagagtctctgattaagattcaccacactgatgtgcctctctcttactat
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

132

Amino Acids

14.84

Weight (kDa)

6.83

Isoelectric Point (pI)

43.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000196)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G65560
fragaria_vesca FvH4_1g00330 FvH4_1g00342 FvH4_1g00343 FvH4_1g00344 FvH4_1g00345 FvH4_1g00345 FvH4_1g00346 FvH4_1g26520
malus_domestica MD02G1001800.v1.1 MD02G1001900.v1.1 MD02G1002100.v1.1 MD02G1002300.v1.1 MD02G1002400.v1.1 MD02G1002500.v1.1 MD02G1002600.v1.1 MD15G1145700.v1.1
prunus_persica Prupe.7G268600_v2.0.a1 Prupe.7G268700_v2.0.a1 Prupe.7G268800_v2.0.a1 Prupe.7G268800_v2.0.a1 Prupe.7G268900_v2.0.a1
pyrus_communis pycom02g00050 pycom02g00060 pycom02g00100 pycom02g00120 pycom02g00130 pycom15g13090 pycom15g13100
rosa_chinensis RchiOBHm_Chr1g0325321 RchiOBHm_Chr1g0325341 RchiOBHm_Chr1g0325351 RchiOBHm_Chr1g0325361 RchiOBHm_Chr1g0364881 RchiOBHm_Chr1g0364891 RchiOBHm_Chr2g0084701 RchiOBHm_Chr2g0084721 RchiOBHm_Chr2g0084731 RchiOBHm_Chr2g0084741 RchiOBHm_Chr2g0084751 RchiOBHm_Chr2g0084761 RchiOBHm_Chr2g0084771 RchiOBHm_Chr2g0085311 RchiOBHm_Chr2g0085321 RchiOBHm_Chr2g0085341 RchiOBHm_Chr2g0085351 RchiOBHm_Chr2g0117721 RchiOBHm_Chr2g0159631 RchiOBHm_Chr3g0484011 RchiOBHm_Chr5g0021141 RchiOBHm_Chr5g0061081 RchiOBHm_Chr6g0275731 RchiOBHm_Chr7g0238011
rosa_laevigata RLG00000013438 RLG00000015632 RLG00000015634 RLG00000015635 RLG00000015636 RLG00000015637 RLG00000015677 RLG00000015679 RLG00000030145 RLG00000030146 RLG00000035427
rosa_multiflora Rmu_co8334849.1_g000001 Rmu_sc0001366.1_g000035 Rmu_sc0002352.1_g000003 Rmu_sc0002352.1_g000004 Rmu_sc0002352.1_g000006 Rmu_sc0002352.1_g000007 Rmu_sc0002352.1_g000009 Rmu_sc0002586.1_g000008 Rmu_sc0004966.1_g000016 Rmu_sc0007122.1_g000001 Rmu_sc0008804.1_g000002 Rmu_sc0008883.1_g000001 Rmu_sc0010860.1_g000002 Rmu_sc0012119.1_g000001 Rmu_sc0012119.1_g000003 Rmu_sc0012119.1_g000006 Rmu_sc0012119.1_g000007 Rmu_sc0012119.1_g000009 Rmu_sc0020031.1_g000004 Rmu_sc0020800.1_g000005 Rmu_sc0020800.1_g000007 Rmu_sc0020800.1_g000008 Rmu_sc0020800.1_g000009 Rmu_sc0025597.1_g000001 Rmu_sc0029132.1_g000002
rosa_roxburghii Rroxscaffold_2G00155450 Rroxscaffold_2G00155460 Rroxscaffold_2G00155470 Rroxscaffold_2G00155830 Rroxscaffold_2G00155840 Rroxscaffold_2G00155850 Rroxscaffold_2G00155860 Rroxscaffold_2G00155870 Rroxscaffold_2G00155910 Rroxscaffold_3G00273850 Rroxscaffold_4G00324820 Rroxscaffold_7G00192930 Rroxscaffold_7G00192960
rosa_rugosa Rorug01G0051300 Rorug01G0051400 Rorug01G0455700 Rorug01G0455800 Rorug01G0455900 Rorug01G0459500 Rorug01G0459500 Rorug01G0459600 Rorug01G0459700 Rorug01G0459700 Rorug02G0335000
rosa_samantha Rh1AG066500 Rh1BG054700 Rh1BG054800 Rh1BG176600 Rh2BG004400 Rh2BG004500 Rh2BG004600 Rh2BG004700 Rh2BG008600 Rh2BG008700 Rh2CG004500 Rh2CG004700 Rh2CG004800 Rh2CG004900 Rh2CG005000 Rh2CG005100 Rh2CG005200 Rh2CG009300 Rh2CG009400 Rh2DG004200 Rh2DG004300 Rh2DG004400 Rh2DG004500 Rh2DG004600 Rh2DG009800 Rh5BG411800 Rh5CG167200 Rh5CG436800 Rh5CG578800 Rh6DG203800
rosa_wichuraiana Rw1G005560 Rw2G000320 Rw2G000350 Rw2G000360 Rw2G000370 Rw2G000750 Rw2G000760 Rw4G022130 Rw5G015810 Rw5G037620 Rw6G018120 Rw7G038530

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 22
Acc36I ACCTGC 1 cut(s) 22
AfiI CCNNNNNNNGG 1 cut(s) 242
AjnI CCWGG 2 cut(s) 264, 292
AleI CACNNNNGTG 1 cut(s) 377
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
Alw26I GTCTC 1 cut(s) 357
AoxI GGCC 2 cut(s) 130, 200
AspS9I GGNCC 1 cut(s) 201
AsuC2I CCSGG 2 cut(s) 228, 274
AsuHPI GGTGA 4 cut(s) 46, 46, 334, 359
AsuII TTCGAA 1 cut(s) 42
BbsI GAAGAC 1 cut(s) 51
BceAI ACGGC 1 cut(s) 165
BciT130I CCWGG 2 cut(s) 266, 294
BciVI GTATCC 1 cut(s) 271
BcnI CCSGG 2 cut(s) 228, 274
BcoDI GTCTC 1 cut(s) 357
BfaI CTAG 1 cut(s) 6
BfuAI ACCTGC 1 cut(s) 22
BfuI GTATCC 1 cut(s) 271
Bme1390I CCNGG 4 cut(s) 228, 266, 274, 294
BmgT120I GGNCC 1 cut(s) 201
BmrFI CCNGG 4 cut(s) 228, 266, 274, 294
BpiI GAAGAC 1 cut(s) 51
Bpu14I TTCGAA 1 cut(s) 42
BpuEI CTTGAG 1 cut(s) 92
BpuMI CCSGG 2 cut(s) 228, 274
BsaJI CCNNGG 2 cut(s) 273, 293
Bsc4I CCNNNNNNNGG 1 cut(s) 242
Bse118I RCCGGY 1 cut(s) 56
Bse1I ACTGG 3 cut(s) 133, 247, 322
BseBI CCWGG 2 cut(s) 266, 294
BseDI CCNNGG 2 cut(s) 273, 293
BseLI CCNNNNNNNGG 1 cut(s) 242
BseNI ACTGG 3 cut(s) 133, 247, 322
BseRI GAGGAG 1 cut(s) 125
BshFI GGCC 2 cut(s) 132, 202
BsiSI CCGG 3 cut(s) 57, 228, 273
BslFI GGGAC 1 cut(s) 311
BslI CCNNNNNNNGG 1 cut(s) 242
BsmAI GTCTC 1 cut(s) 357
BsmFI GGGAC 1 cut(s) 311
BsnI GGCC 2 cut(s) 132, 202
Bsp119I TTCGAA 1 cut(s) 42
BspANI GGCC 2 cut(s) 132, 202
BspMI ACCTGC 1 cut(s) 22
BspT104I TTCGAA 1 cut(s) 42
BsrFI RCCGGY 1 cut(s) 56
BsrI ACTGG 3 cut(s) 133, 247, 322
BssAI RCCGGY 1 cut(s) 56
BssECI CCNNGG 2 cut(s) 273, 293
Bst2UI CCWGG 2 cut(s) 266, 294
BstBI TTCGAA 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 233
BstMAI GTCTC 1 cut(s) 357
BstMWI GCNNNNNNNGC 2 cut(s) 199, 232
BstNI CCWGG 2 cut(s) 266, 294
BstNSI RCATGY 1 cut(s) 175
BstSCI CCNGG 4 cut(s) 226, 264, 272, 292
BstV2I GAAGAC 1 cut(s) 51
BsuI GTATCC 1 cut(s) 271
BsuRI GGCC 2 cut(s) 132, 202
BtsI GCAGTG 1 cut(s) 90
BtsIMutI CAGTG 2 cut(s) 90, 372
BveI ACCTGC 1 cut(s) 22
Cac8I GCNNGC 1 cut(s) 233
Cfr10I RCCGGY 1 cut(s) 56
Cfr13I GGNCC 1 cut(s) 201
CviAII CATG 1 cut(s) 172
CviJI RGCY 9 cut(s) 5, 60, 112, 132, 180, 202, 231, 257, 292
CviKI_1 RGCY 9 cut(s) 5, 60, 112, 132, 180, 202, 231, 257, 292
EcoRII CCWGG 2 cut(s) 264, 292
FaeI CATG 1 cut(s) 175
FaiI YATR 5 cut(s) 51, 173, 185, 210, 333
FaqI GGGAC 1 cut(s) 311
FatI CATG 1 cut(s) 171
FspBI CTAG 1 cut(s) 6
HaeIII GGCC 2 cut(s) 132, 202
HapII CCGG 3 cut(s) 57, 228, 273
Hin1II CATG 1 cut(s) 175
HindIII AAGCTT 1 cut(s) 110
HinfI GANTC 4 cut(s) 71, 269, 350, 364
HpaII CCGG 3 cut(s) 57, 228, 273
HphI GGTGA 4 cut(s) 46, 46, 334, 359
Hpy188I TCNGA 3 cut(s) 76, 315, 357
Hpy188III TCNNGA 3 cut(s) 11, 116, 142
HpyAV CCTTC 2 cut(s) 113, 229
HpyF10VI GCNNNNNNNGC 2 cut(s) 199, 232
Hsp92II CATG 1 cut(s) 175
MaeI CTAG 1 cut(s) 6
MaeIII GTNAC 1 cut(s) 238
MboII GAAGA 4 cut(s) 26, 34, 56, 338
MluCI AATT 1 cut(s) 83
MlyI GAGTC 1 cut(s) 359
MmeI TCCRAC 1 cut(s) 99
MnlI CCTC 5 cut(s) 89, 143, 146, 158, 393
MseI TTAA 2 cut(s) 288, 360
MslI CAYNNNNRTG 2 cut(s) 375, 377
MspI CCGG 3 cut(s) 57, 228, 273
MspR9I CCNGG 4 cut(s) 228, 266, 274, 294
MvaI CCWGG 2 cut(s) 266, 294
MwoI GCNNNNNNNGC 2 cut(s) 199, 232
NciI CCSGG 2 cut(s) 228, 274
NlaIII CATG 1 cut(s) 175
NmuCI GTSAC 1 cut(s) 238
NspI RCATGY 1 cut(s) 175
NspV TTCGAA 1 cut(s) 42
OliI CACNNNNGTG 1 cut(s) 377
PaqCI CACCTGC 1 cut(s) 22
PfeI GAWTC 3 cut(s) 71, 269, 364
PfoI TCCNGGA 1 cut(s) 264
PleI GAGTC 1 cut(s) 358
PpsI GAGTC 1 cut(s) 358
Psp6I CCWGG 2 cut(s) 264, 292
PspGI CCWGG 2 cut(s) 264, 292
PspPI GGNCC 1 cut(s) 201
RseI CAYNNNNRTG 2 cut(s) 375, 377
SaqAI TTAA 2 cut(s) 288, 360
Sau96I GGNCC 1 cut(s) 201
SchI GAGTC 1 cut(s) 359
ScrFI CCNGG 4 cut(s) 228, 266, 274, 294
SetI ASST 5 cut(s) 36, 81, 114, 124, 150
SfuI TTCGAA 1 cut(s) 42
SmiMI CAYNNNNRTG 2 cut(s) 375, 377
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
Sse9I AATT 1 cut(s) 83
SspMI CTAG 1 cut(s) 6
StyD4I CCNGG 4 cut(s) 226, 264, 272, 292
TaqI TCGA 3 cut(s) 10, 42, 125
TasI AATT 1 cut(s) 83
TfiI GAWTC 3 cut(s) 71, 269, 364
Tru1I TTAA 2 cut(s) 288, 360
Tru9I TTAA 2 cut(s) 288, 360
TscAI CASTG 2 cut(s) 97, 379
TseFI GTSAC 1 cut(s) 238
Tsp45I GTSAC 1 cut(s) 238
TspRI CASTG 2 cut(s) 97, 379
XceI RCATGY 1 cut(s) 175
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.