MD03G1179800.v1.1

oxidoreductase activity, acting on superoxide radicals as acceptor

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
Physical Location & Seq
Reverse (-)
24696540 .. 24697542
1003 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1179800.v1.1.491

Sequence Viewer

Length: 141 bp
ATGCATATTAAGCACAGATTGGTCAGGGAAAAGGTGAATACACACCTCACGCCCCGCCCAATATTACTTACTAGGCATGGAGAGAGTAAGGATAATGTTAGAGGCAGAATTGGAGAAGACAATCCTTTGAGGAGGAAGTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

47

Amino Acids

5.48

Weight (kDa)

11.55

Isoelectric Point (pI)

54.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000260)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g01701 FvH4_4g03270
malus_domestica MD00G1017800.v1.1 MD00G1142300.v1.1 MD00G1145500.v1.1 MD00G1191000.v1.1 MD01G1112800.v1.1 MD01G1143700.v1.1 MD02G1048600.v1.1 MD02G1196000.v1.1 MD03G1062700.v1.1 MD03G1095500.v1.1 MD03G1095600.v1.1 MD03G1125500.v1.1 MD03G1154200.v1.1 MD03G1154300.v1.1 MD03G1170400.v1.1 MD03G1179800.v1.1 MD03G1196800.v1.1 MD03G1255700.v1.1 MD04G1029900.v1.1 MD04G1054700.v1.1 MD04G1102500.v1.1 MD04G1142700.v1.1 MD05G1052900.v1.1 MD05G1063000.v1.1 MD05G1069200.v1.1 MD05G1160700.v1.1 MD05G1235500.v1.1 MD05G1285100.v1.1 MD05G1321300.v1.1 MD07G1170900.v1.1 MD08G1072400.v1.1 MD08G1151000.v1.1 MD09G1075100.v1.1 MD11G1004200.v1.1 MD11G1134000.v1.1 MD11G1134100.v1.1 MD11G1150600.v1.1 MD11G1167200.v1.1 MD11G1169500.v1.1 MD11G1191200.v1.1 MD11G1215700.v1.1 MD12G1110400.v1.1 MD12G1226000.v1.1 MD14G1070600.v1.1 MD15G1246900.v1.1 MD15G1271300.v1.1 MD15G1304400.v1.1 MD15G1306500.v1.1 MD15G1394800.v1.1 MD16G1222400.v1.1 MD16G1235600.v1.1 MD16G1275200.v1.1 MD17G1164900.v1.1 MD17G1199400.v1.1 MD17G1200600.v1.1 MD17G1255500.v1.1
prunus_persica Prupe.5G199500_v2.0.a1
pyrus_communis pycom01g05550 pycom01g06510 pycom01g10640 pycom02g04780 pycom02g10380 pycom02g16940 pycom02g21170 pycom02g25250 pycom03g11350 pycom03g15980 pycom03g17500 pycom04g07430 pycom04g11390 pycom05g02890 pycom05g12620 pycom05g21240 pycom06g01740 pycom06g06680 pycom06g08420 pycom07g09890 pycom07g10330 pycom07g13390 pycom07g13400 pycom07g14390 pycom08g04050 pycom08g04060 pycom08g09610 pycom08g14690 pycom09g14670 pycom09g14680 pycom09g19450 pycom10g09940 pycom10g14290 pycom11g03600 pycom11g13710 pycom11g14810 pycom11g17720 pycom12g02240 pycom12g06830 pycom12g09950 pycom12g13060 pycom13g02180 pycom13g07740 pycom13g21900 pycom13g23040 pycom14g10400 pycom14g10410 pycom14g10490 pycom14g10680 pycom14g13340 pycom15g15950 pycom15g31530 pycom15g31550 pycom15g38660 pycom16g08600 pycom16g20570 pycom17g09630 pycom17g09650 pycom17g16800 pycom17g16830 pycom17g24070
rosa_chinensis RchiOBHm_Chr2g0086631
rosa_laevigata RLG00000015768
rosa_multiflora Rmu_co8061662.1_g000001 Rmu_co8118782.1_g000001
rosa_roxburghii Rroxscaffold_2G00154370
rosa_rugosa Rorug01G0468000
rosa_samantha Rh2AG019800 Rh2BG019700 Rh2BG019800 Rh2CG019500 Rh2DG020300
rosa_wichuraiana Rw2G001640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 55
AsuHPI GGTGA 1 cut(s) 46
BbsI GAAGAC 1 cut(s) 123
BfaI CTAG 1 cut(s) 72
BpiI GAAGAC 1 cut(s) 123
BspACI CCGC 1 cut(s) 55
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstV2I GAAGAC 1 cut(s) 123
CviAII CATG 1 cut(s) 77
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 80
FaiI YATR 2 cut(s) 6, 78
FatI CATG 1 cut(s) 76
FauI CCCGC 1 cut(s) 62
FspBI CTAG 1 cut(s) 72
Hin1II CATG 1 cut(s) 80
HphI GGTGA 1 cut(s) 46
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
Hsp92II CATG 1 cut(s) 80
LpnPI CCDG 1 cut(s) 10
MaeI CTAG 1 cut(s) 72
MboII GAAGA 1 cut(s) 128
MluCI AATT 1 cut(s) 108
MnlI CCTC 4 cut(s) 56, 95, 123, 126
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 9
MwoI GCNNNNNNNGC 1 cut(s) 10
NlaIII CATG 1 cut(s) 80
NsiI ATGCAT 1 cut(s) 6
SaqAI TTAA 1 cut(s) 9
SetI ASST 2 cut(s) 36, 48
SgeI CNNG 5 cut(s) 37, 61, 66, 84, 89
Sse9I AATT 1 cut(s) 108
SsiI CCGC 1 cut(s) 55
SspI AATATT 1 cut(s) 63
SspMI CTAG 1 cut(s) 72
TasI AATT 1 cut(s) 108
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
XspI CTAG 1 cut(s) 72
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.