MD11G1215700.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
31509488 .. 31509855
368 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1215700.v1.1.491

Sequence Viewer

Length: 168 bp
ATGGAGGACATATCCCCTGAGGTCAGTGCCTACTTAGACGAGACCTTAGCAAGTCGGTACAAAGATTGGAAGAGTGTTCTTCACAAGCATTTTCAGCTATGGGAATCTCCGGAGATTGGTCGCCTACAGGGTTGCCCACTCGAGTATAAGGAGCGGCGAGAGGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.61

Weight (kDa)

5.05

Isoelectric Point (pI)

74.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000260)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g01701 FvH4_4g03270
malus_domestica MD00G1017800.v1.1 MD00G1142300.v1.1 MD00G1145500.v1.1 MD00G1191000.v1.1 MD01G1112800.v1.1 MD01G1143700.v1.1 MD02G1048600.v1.1 MD02G1196000.v1.1 MD03G1062700.v1.1 MD03G1095500.v1.1 MD03G1095600.v1.1 MD03G1125500.v1.1 MD03G1154200.v1.1 MD03G1154300.v1.1 MD03G1170400.v1.1 MD03G1179800.v1.1 MD03G1196800.v1.1 MD03G1255700.v1.1 MD04G1029900.v1.1 MD04G1054700.v1.1 MD04G1102500.v1.1 MD04G1142700.v1.1 MD05G1052900.v1.1 MD05G1063000.v1.1 MD05G1069200.v1.1 MD05G1160700.v1.1 MD05G1235500.v1.1 MD05G1285100.v1.1 MD05G1321300.v1.1 MD07G1170900.v1.1 MD08G1072400.v1.1 MD08G1151000.v1.1 MD09G1075100.v1.1 MD11G1004200.v1.1 MD11G1134000.v1.1 MD11G1134100.v1.1 MD11G1150600.v1.1 MD11G1167200.v1.1 MD11G1169500.v1.1 MD11G1191200.v1.1 MD11G1215700.v1.1 MD12G1110400.v1.1 MD12G1226000.v1.1 MD14G1070600.v1.1 MD15G1246900.v1.1 MD15G1271300.v1.1 MD15G1304400.v1.1 MD15G1306500.v1.1 MD15G1394800.v1.1 MD16G1222400.v1.1 MD16G1235600.v1.1 MD16G1275200.v1.1 MD17G1164900.v1.1 MD17G1199400.v1.1 MD17G1200600.v1.1 MD17G1255500.v1.1
prunus_persica Prupe.5G199500_v2.0.a1
pyrus_communis pycom01g05550 pycom01g06510 pycom01g10640 pycom02g04780 pycom02g10380 pycom02g16940 pycom02g21170 pycom02g25250 pycom03g11350 pycom03g15980 pycom03g17500 pycom04g07430 pycom04g11390 pycom05g02890 pycom05g12620 pycom05g21240 pycom06g01740 pycom06g06680 pycom06g08420 pycom07g09890 pycom07g10330 pycom07g13390 pycom07g13400 pycom07g14390 pycom08g04050 pycom08g04060 pycom08g09610 pycom08g14690 pycom09g14670 pycom09g14680 pycom09g19450 pycom10g09940 pycom10g14290 pycom11g03600 pycom11g13710 pycom11g14810 pycom11g17720 pycom12g02240 pycom12g06830 pycom12g09950 pycom12g13060 pycom13g02180 pycom13g07740 pycom13g21900 pycom13g23040 pycom14g10400 pycom14g10410 pycom14g10490 pycom14g10680 pycom14g13340 pycom15g15950 pycom15g31530 pycom15g31550 pycom15g38660 pycom16g08600 pycom16g20570 pycom17g09630 pycom17g09650 pycom17g16800 pycom17g16830 pycom17g24070
rosa_chinensis RchiOBHm_Chr2g0086631
rosa_laevigata RLG00000015768
rosa_multiflora Rmu_co8061662.1_g000001 Rmu_co8118782.1_g000001
rosa_roxburghii Rroxscaffold_2G00154370
rosa_rugosa Rorug01G0468000
rosa_samantha Rh2AG019800 Rh2BG019700 Rh2BG019800 Rh2CG019500 Rh2DG020300
rosa_wichuraiana Rw2G001640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 154
AccIII TCCGGA 1 cut(s) 109
AciI CCGC 1 cut(s) 154
AfaI GTAC 1 cut(s) 59
AfiI CCNNNNNNNGG 1 cut(s) 116
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
Alw26I GTCTC 1 cut(s) 35
Ama87I CYCGRG 1 cut(s) 140
Aor13HI TCCGGA 1 cut(s) 109
AvaI CYCGRG 1 cut(s) 140
AxyI CCTNAGG 1 cut(s) 18
BcoDI GTCTC 1 cut(s) 35
BfmI CTRYAG 1 cut(s) 125
BisI GCNGC 1 cut(s) 155
BlsI GCNGC 1 cut(s) 156
BmeT110I CYCGRG 1 cut(s) 140
Bpu10I CCTNAGC 1 cut(s) 46
BsaI GGTCTC 1 cut(s) 35
BsaWI WCCGGW 1 cut(s) 109
Bsc4I CCNNNNNNNGG 1 cut(s) 116
Bse21I CCTNAGG 1 cut(s) 18
BseAI TCCGGA 1 cut(s) 109
BseLI CCNNNNNNNGG 1 cut(s) 116
BseMII CTCAG 1 cut(s) 9
BsiHKCI CYCGRG 1 cut(s) 140
BsiSI CCGG 1 cut(s) 110
BslI CCNNNNNNNGG 1 cut(s) 116
BsmAI GTCTC 1 cut(s) 35
Bso31I GGTCTC 1 cut(s) 35
BsoBI CYCGRG 1 cut(s) 140
Bsp13I TCCGGA 1 cut(s) 109
BspACI CCGC 1 cut(s) 154
BspCNI CTCAG 1 cut(s) 10
BspEI TCCGGA 1 cut(s) 109
BspTNI GGTCTC 1 cut(s) 35
BsrBI CCGCTC 1 cut(s) 154
Bst6I CTCTTC 1 cut(s) 65
BstDEI CTNAG 3 cut(s) 18, 34, 46
BstMAI GTCTC 1 cut(s) 35
BstMWI GCNNNNNNNGC 1 cut(s) 94
BstSFI CTRYAG 1 cut(s) 125
Bsu36I CCTNAGG 1 cut(s) 18
BtsIMutI CAGTG 1 cut(s) 31
Csp6I GTAC 1 cut(s) 58
CviJI RGCY 1 cut(s) 97
CviKI_1 RGCY 1 cut(s) 97
CviQI GTAC 1 cut(s) 58
DdeI CTNAG 3 cut(s) 18, 34, 46
Eam1104I CTCTTC 1 cut(s) 65
EarI CTCTTC 1 cut(s) 65
Eco31I GGTCTC 1 cut(s) 35
Eco81I CCTNAGG 1 cut(s) 18
Eco88I CYCGRG 1 cut(s) 140
FaiI YATR 3 cut(s) 11, 100, 147
Fnu4HI GCNGC 1 cut(s) 155
Fsp4HI GCNGC 1 cut(s) 155
GluI GCNGC 1 cut(s) 155
HapII CCGG 1 cut(s) 110
HinfI GANTC 1 cut(s) 104
HpaII CCGG 1 cut(s) 110
Hpy188III TCNNGA 1 cut(s) 110
HpyF10VI GCNNNNNNNGC 1 cut(s) 94
HpyF3I CTNAG 3 cut(s) 18, 34, 46
Kpn2I TCCGGA 1 cut(s) 109
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 3 cut(s) 30, 113, 123
MbiI CCGCTC 1 cut(s) 154
MboII GAAGA 2 cut(s) 71, 82
MnlI CCTC 2 cut(s) 13, 154
MroI TCCGGA 1 cut(s) 109
MspI CCGG 1 cut(s) 110
MwoI GCNNNNNNNGC 1 cut(s) 94
PaeR7I CTCGAG 1 cut(s) 140
PfeI GAWTC 1 cut(s) 104
PkrI GCNGC 1 cut(s) 156
PspXI VCTCGAGB 1 cut(s) 140
RsaI GTAC 1 cut(s) 59
RsaNI GTAC 1 cut(s) 58
SatI GCNGC 1 cut(s) 155
SetI ASST 3 cut(s) 24, 47, 99
SfcI CTRYAG 1 cut(s) 125
Sfr274I CTCGAG 1 cut(s) 140
SgeI CNNG 8 cut(s) 29, 52, 63, 97, 122, 140, 152, 154
SlaI CTCGAG 1 cut(s) 140
SmlI CTYRAG 1 cut(s) 140
SmoI CTYRAG 1 cut(s) 140
SsiI CCGC 1 cut(s) 154
TaqI TCGA 1 cut(s) 141
TauI GCSGC 1 cut(s) 157
TfiI GAWTC 1 cut(s) 104
TscAI CASTG 1 cut(s) 31
TspRI CASTG 1 cut(s) 31
XhoI CTCGAG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.