MD09G1075100.v1.1

Plant transposase (Ptta/En/Spm family)

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
5245931 .. 5246265
335 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1075100.v1.1.491

Sequence Viewer

Length: 159 bp
ATGGGAATCTCCGGAGATTGCTCGCCTACAGGGTTGCCCACTCGAAATAAATCTGTTGTTGGCAAGAAAGCTCGGGACTCAAAGACACTTCTCCACCATTCCAGTTCGAAGCCCTTTTCGTATAGGGTTGAGGCACGACGTGAGGTAAAAGTATATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

5.76

Weight (kDa)

10.22

Isoelectric Point (pI)

39.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000260)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g01701 FvH4_4g03270
malus_domestica MD00G1017800.v1.1 MD00G1142300.v1.1 MD00G1145500.v1.1 MD00G1191000.v1.1 MD01G1112800.v1.1 MD01G1143700.v1.1 MD02G1048600.v1.1 MD02G1196000.v1.1 MD03G1062700.v1.1 MD03G1095500.v1.1 MD03G1095600.v1.1 MD03G1125500.v1.1 MD03G1154200.v1.1 MD03G1154300.v1.1 MD03G1170400.v1.1 MD03G1179800.v1.1 MD03G1196800.v1.1 MD03G1255700.v1.1 MD04G1029900.v1.1 MD04G1054700.v1.1 MD04G1102500.v1.1 MD04G1142700.v1.1 MD05G1052900.v1.1 MD05G1063000.v1.1 MD05G1069200.v1.1 MD05G1160700.v1.1 MD05G1235500.v1.1 MD05G1285100.v1.1 MD05G1321300.v1.1 MD07G1170900.v1.1 MD08G1072400.v1.1 MD08G1151000.v1.1 MD09G1075100.v1.1 MD11G1004200.v1.1 MD11G1134000.v1.1 MD11G1134100.v1.1 MD11G1150600.v1.1 MD11G1167200.v1.1 MD11G1169500.v1.1 MD11G1191200.v1.1 MD11G1215700.v1.1 MD12G1110400.v1.1 MD12G1226000.v1.1 MD14G1070600.v1.1 MD15G1246900.v1.1 MD15G1271300.v1.1 MD15G1304400.v1.1 MD15G1306500.v1.1 MD15G1394800.v1.1 MD16G1222400.v1.1 MD16G1235600.v1.1 MD16G1275200.v1.1 MD17G1164900.v1.1 MD17G1199400.v1.1 MD17G1200600.v1.1 MD17G1255500.v1.1
prunus_persica Prupe.5G199500_v2.0.a1
pyrus_communis pycom01g05550 pycom01g06510 pycom01g10640 pycom02g04780 pycom02g10380 pycom02g16940 pycom02g21170 pycom02g25250 pycom03g11350 pycom03g15980 pycom03g17500 pycom04g07430 pycom04g11390 pycom05g02890 pycom05g12620 pycom05g21240 pycom06g01740 pycom06g06680 pycom06g08420 pycom07g09890 pycom07g10330 pycom07g13390 pycom07g13400 pycom07g14390 pycom08g04050 pycom08g04060 pycom08g09610 pycom08g14690 pycom09g14670 pycom09g14680 pycom09g19450 pycom10g09940 pycom10g14290 pycom11g03600 pycom11g13710 pycom11g14810 pycom11g17720 pycom12g02240 pycom12g06830 pycom12g09950 pycom12g13060 pycom13g02180 pycom13g07740 pycom13g21900 pycom13g23040 pycom14g10400 pycom14g10410 pycom14g10490 pycom14g10680 pycom14g13340 pycom15g15950 pycom15g31530 pycom15g31550 pycom15g38660 pycom16g08600 pycom16g20570 pycom17g09630 pycom17g09650 pycom17g16800 pycom17g16830 pycom17g24070
rosa_chinensis RchiOBHm_Chr2g0086631
rosa_laevigata RLG00000015768
rosa_multiflora Rmu_co8061662.1_g000001 Rmu_co8118782.1_g000001
rosa_roxburghii Rroxscaffold_2G00154370
rosa_rugosa Rorug01G0468000
rosa_samantha Rh2AG019800 Rh2BG019700 Rh2BG019800 Rh2CG019500 Rh2DG020300
rosa_wichuraiana Rw2G001640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 11
AdeI CACNNNGTG 1 cut(s) 140
AjiI CACGTC 1 cut(s) 140
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Ama87I CYCGRG 1 cut(s) 72
Aor13HI TCCGGA 1 cut(s) 11
AsuII TTCGAA 1 cut(s) 107
AvaI CYCGRG 1 cut(s) 72
BfmI CTRYAG 1 cut(s) 27
BmeT110I CYCGRG 1 cut(s) 72
BmgBI CACGTC 1 cut(s) 140
Bpu14I TTCGAA 1 cut(s) 107
BsaWI WCCGGW 1 cut(s) 11
Bse1I ACTGG 1 cut(s) 102
BseAI TCCGGA 1 cut(s) 11
BseNI ACTGG 1 cut(s) 102
BsiHKCI CYCGRG 1 cut(s) 72
BsiSI CCGG 1 cut(s) 12
BslFI GGGAC 1 cut(s) 89
BsmFI GGGAC 1 cut(s) 89
BsoBI CYCGRG 1 cut(s) 72
Bsp119I TTCGAA 1 cut(s) 107
Bsp13I TCCGGA 1 cut(s) 11
BspEI TCCGGA 1 cut(s) 11
BspT104I TTCGAA 1 cut(s) 107
BsrI ACTGG 1 cut(s) 102
BstBI TTCGAA 1 cut(s) 107
BstC8I GCNNGC 1 cut(s) 23
BstSFI CTRYAG 1 cut(s) 27
BtrI CACGTC 1 cut(s) 140
Cac8I GCNNGC 1 cut(s) 23
CviJI RGCY 2 cut(s) 71, 112
CviKI_1 RGCY 2 cut(s) 71, 112
DraIII CACNNNGTG 1 cut(s) 140
Eco88I CYCGRG 1 cut(s) 72
FaiI YATR 2 cut(s) 123, 154
FaqI GGGAC 1 cut(s) 89
HapII CCGG 1 cut(s) 12
HinfI GANTC 2 cut(s) 6, 77
HpaII CCGG 1 cut(s) 12
Hpy188III TCNNGA 2 cut(s) 12, 74
Hpy99I CGWCG 1 cut(s) 141
HpyCH4IV ACGT 1 cut(s) 139
HpySE526I ACGT 1 cut(s) 139
Kpn2I TCCGGA 1 cut(s) 11
LpnPI CCDG 3 cut(s) 15, 25, 115
MaeII ACGT 1 cut(s) 139
MlyI GAGTC 1 cut(s) 71
MnlI CCTC 2 cut(s) 124, 136
MroI TCCGGA 1 cut(s) 11
MseI TTAA 1 cut(s) 157
MspI CCGG 1 cut(s) 12
NspV TTCGAA 1 cut(s) 107
PfeI GAWTC 1 cut(s) 6
PleI GAGTC 1 cut(s) 71
PpsI GAGTC 1 cut(s) 71
SaqAI TTAA 1 cut(s) 157
SchI GAGTC 1 cut(s) 71
SetI ASST 3 cut(s) 73, 142, 147
SfcI CTRYAG 1 cut(s) 27
SfuI TTCGAA 1 cut(s) 107
TaiI ACGT 1 cut(s) 142
TaqI TCGA 2 cut(s) 43, 107
TfiI GAWTC 1 cut(s) 6
Tru1I TTAA 1 cut(s) 157
Tru9I TTAA 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.