Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0019190.1

Orthogroup ID

OG0000466

Physical Location & Seq

Genomic Coordinates Forward (+)

8475 .. 15532

Gene Structure 7058 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0019190.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1215 bp

atgaggatggtcattgtgattagtgtggtaatggtgcaatggttcggtatcatagccagtcttaagtggatatggaagaattggttcattattgtggtgacatggaacgtaatagccagtcttgggtggatatggaagagtaggttcagttgcatggttgaaaccccagagccaatatcagaggataatcaagaactggttgacgtcgatgcctctgcatctcttccttcatcatcagctcctaggtggaagcatgatgtctttttgagtttcaggggtgaggacactcgtaggggtattacatcctttttatacgatcgactgaaaaacagaggaatcaaaacattcatggatggccaagaccttcaagtaggggatgttatttctcccactctcctaatggcaattaaagaatcaaggtttgcaattattgttctctctccaaactatgcctcttccacttggtgtttggaggaacttagaaacatttgtgaacgcatgaaagaagacaacaatagaattctgccacttttttataatgtggatcctagtgatgtacgaaatcagaagaggagttttggagatgctttcactaagcatgaaaaatctgggaaacacaaatcaggaaaggtgcagcagtggagagaagctttaaaaaaagtggcaaatttctctggatggcatacactgaattataaaactgatagagaacttgtggatgccattgaggaatctgtgtgcaataaattacgactgactgaacctgtgcttaaaatgtgcatcggaggttttaaagaatttgcagcaacaaaacaagccattgataaggtcatgaacgcgctaaatgatgatgaggccactaccattggagtctacggaatggggggcgttggaaagacgacaatgggaattcctttagtgatatattggaaagatgcattttctacttatgttgctttgccacttcaacaagctttactgtcagtaatacaaaggtatgcacttatctgggatgttggctgtggcattgggggatgtgacctttacatggccaatacgtttgatgttgatgttgttggcattgacctctctgtaaacatgatttgctttgcccttgaacaatccattggactcaaatgtgctgttgagtttgaagttgctgattgcaccacgaaaacatatcttgacaataaatttgatgatatgcagccgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0006950 GO:0006952 GO:0007154 GO:0007165 GO:0008150 GO:0009987 GO:0016020 GO:0023052 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko04626 map04626

Pfam Domains

Protein Families

LRR_8 NB-ARC TIR

Protein Analysis

404

Amino Acids

45.74

Weight (kDa)

5.75

Isoelectric Point (pI)

39.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000466)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g35831 FvH4_3g44041 FvH4_5g15070 FvH4_5g15070 FvH4_7g08891
malus_domestica	MD12G1125500.v1.1
prunus_persica	Prupe.2G112700_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0322841 RchiOBHm_Chr1g0323391 RchiOBHm_Chr1g0327991 RchiOBHm_Chr1g0328961 RchiOBHm_Chr5g0080091 RchiOBHm_Chr6g0244841 RchiOBHm_Chr6g0250491
rosa_laevigata	RLG00000024005 RLG00000024011 RLG00000024013 RLG00000024016 RLG00000024020 RLG00000024393 RLG00000030320 RLG00000030327 RLG00000030347 RLG00000030348 RLG00000030353 RLG00000030374 RLG00000034792 RLG00000035452 RLG00000036087 RLG00000036760 RLG00000036762 RLG00000036764 RLG00000036766 RLG00000036814 RLG00000036815 RLG00000036818 RLG00000036827 RLG00000036828 RLG00000036830 RLG00000036831 RLG00000036833 RLG00000036835
rosa_multiflora	Rmu_co8082032.1_g000001 Rmu_co8162460.1_g000001 Rmu_co8167342.1_g000001 Rmu_co8180788.1_g000001 Rmu_co8300873.1_g000001 Rmu_sc0000252.1_g000008 Rmu_sc0000588.1_g000050 Rmu_sc0000595.1_g000020 Rmu_sc0000749.1_g000016 Rmu_sc0000749.1_g000039 Rmu_sc0000908.1_g000020 Rmu_sc0001148.1_g000040 Rmu_sc0001148.1_g000041 Rmu_sc0001226.1_g000014 Rmu_sc0001639.1_g000003 Rmu_sc0002075.1_g000005 Rmu_sc0002132.1_g000044 Rmu_sc0002634.1_g000026 Rmu_sc0003418.1_g000010 Rmu_sc0007793.1_g000030 Rmu_sc0012920.1_g000001 Rmu_sc0016164.1_g000016 Rmu_sc0019190.1_g000006 Rmu_sc0019291.1_g000001 Rmu_sc0021169.1_g000003 Rmu_sc0040474.1_g000001
rosa_roxburghii	Rroxscaffold_1G00003030 Rroxscaffold_1G00003240 Rroxscaffold_1G00003280 Rroxscaffold_1G00003530 Rroxscaffold_1G00003600 Rroxscaffold_1G00003920 Rroxscaffold_3G00235100 Rroxscaffold_3G00240330 Rroxscaffold_4G00326470 Rroxscaffold_4G00326760 Rroxscaffold_4G00327070 Rroxscaffold_6G00393840 Rroxscaffold_6G00408110 Rroxscaffold_6G00408180
rosa_rugosa	Rorug01G0036300 Rorug01G0038900 Rorug02G0108200 Rorug05G0459600 Rorug07G0125600 Rorug07G0204700
rosa_samantha	Rh1DG060500 Rh6BG033900
rosa_wichuraiana	Rw0G008150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	537, 696
AatII	GACGTC	1 cut(s)	207
AccI	GTMKAC	1 cut(s)	873
AccII	CGCG	1 cut(s)	839
AclWI	GGATC	2 cut(s)	539, 552
AcoI	YGGCCR	2 cut(s)	355, 1050
AcsI	RAATTY	5 cut(s)	519, 667, 797, 909, 1193
AcyI	GRCGYC	1 cut(s)	204
AdeI	CACNNNGTG	1 cut(s)	465
AfaI	GTAC	1 cut(s)	558
AfiI	CCNNNNNNNGG	2 cut(s)	123, 1048
AflII	CTTAAG	1 cut(s)	62
AgsI	TTSAA	5 cut(s)	161, 368, 968, 1118, 1154
AjuI	GAANNNNNNNTTGG	2 cut(s)	1110, 1142
AluBI	AGCT	3 cut(s)	239, 650, 974
AluI	AGCT	3 cut(s)	239, 650, 974
AlwI	GGATC	2 cut(s)	539, 552
AoxI	GGCC	3 cut(s)	355, 855, 1050
ApeKI	GCWGC	3 cut(s)	634, 803, 1207
ApoI	RAATTY	5 cut(s)	519, 667, 797, 909, 1193
ArsI	GACNNNNNNTTYG	2 cut(s)	1178, 1210
Asp700I	GAANNNNTTC	1 cut(s)	83
AspA2I	CCTAGG	1 cut(s)	242
AspLEI	GCGC	1 cut(s)	841
AsuHPI	GGTGA	2 cut(s)	109, 290
AvrII	CCTAGG	1 cut(s)	242
BalI	TGGCCA	2 cut(s)	357, 1052
BamHI	GGATCC	1 cut(s)	544
BbsI	GAAGAC	1 cut(s)	513
BbvI	GCAGC	2 cut(s)	646, 815
BccI	CCATC	2 cut(s)	347, 672
BceAI	ACGGC	1 cut(s)	1195
BcgI	CGANNNNNNTGC	2 cut(s)	197, 231
BfaI	CTAG	2 cut(s)	243, 549
BfrI	CTTAAG	1 cut(s)	62
BisI	GCNGC	3 cut(s)	635, 804, 1208
BlnI	CCTAGG	1 cut(s)	242
BlsI	GCNGC	3 cut(s)	636, 805, 1209
BmiI	GGNNCC	1 cut(s)	546
BmsI	GCATC	6 cut(s)	199, 227, 574, 709, 789, 925
BpiI	GAAGAC	1 cut(s)	513
BsaHI	GRCGYC	1 cut(s)	204
BsaJI	CCNNGG	1 cut(s)	242
Bsc4I	CCNNNNNNNGG	2 cut(s)	123, 1048
Bse1I	ACTGG	3 cut(s)	57, 117, 201
Bse3DI	GCAATG	1 cut(s)	44
BseDI	CCNNGG	1 cut(s)	242
BseGI	GGATG	8 cut(s)	12, 302, 358, 382, 683, 724, 1018, 1040
BseLI	CCNNNNNNNGG	2 cut(s)	123, 1048
BseMI	GCAATG	1 cut(s)	44
BseNI	ACTGG	3 cut(s)	57, 117, 201
BseRI	GAGGAG	1 cut(s)	586
BseXI	GCAGC	2 cut(s)	646, 815
BsgI	GTGCAG	1 cut(s)	653
Bsh1236I	CGCG	1 cut(s)	839
Bsh1285I	CGRYCG	1 cut(s)	319
BshFI	GGCC	3 cut(s)	357, 857, 1052
BsiEI	CGRYCG	1 cut(s)	319
BslI	CCNNNNNNNGG	2 cut(s)	123, 1048
BsnI	GGCC	3 cut(s)	357, 857, 1052
Bsp143I	GATC	2 cut(s)	316, 544
BspANI	GGCC	3 cut(s)	357, 857, 1052
BspFNI	CGCG	1 cut(s)	839
BspHI	TCATGA	1 cut(s)	831
BspLI	GGNNCC	1 cut(s)	546
BspPI	GGATC	2 cut(s)	539, 552
BspTI	CTTAAG	1 cut(s)	62
BsrDI	GCAATG	1 cut(s)	44
BsrI	ACTGG	3 cut(s)	57, 117, 201
BssECI	CCNNGG	1 cut(s)	242
BssMI	GATC	2 cut(s)	316, 544
BssNI	GRCGYC	1 cut(s)	204
BssT1I	CCWWGG	1 cut(s)	242
Bst4CI	ACNGT	1 cut(s)	981
Bst6I	CTCTTC	4 cut(s)	131, 228, 460, 563
BstACI	GRCGYC	1 cut(s)	204
BstAFI	CTTAAG	1 cut(s)	62
BstDEI	CTNAG	2 cut(s)	479, 594
BstF5I	GGATG	8 cut(s)	12, 302, 358, 382, 683, 724, 1018, 1040
BstFNI	CGCG	1 cut(s)	839
BstHHI	GCGC	1 cut(s)	841
BstKTI	GATC	2 cut(s)	319, 547
BstMBI	GATC	2 cut(s)	316, 544
BstMCI	CGRYCG	1 cut(s)	319
BstUI	CGCG	1 cut(s)	839
BstV1I	GCAGC	2 cut(s)	646, 815
BstV2I	GAAGAC	1 cut(s)	513
BstX2I	RGATCY	1 cut(s)	544
BstYI	RGATCY	1 cut(s)	544
BsuRI	GGCC	3 cut(s)	357, 857, 1052
BtsCI	GGATG	8 cut(s)	12, 302, 358, 382, 683, 724, 1018, 1040
BtsI	GCAGTG	1 cut(s)	644
BtsIMutI	CAGTG	2 cut(s)	644, 686
CciI	TCATGA	1 cut(s)	831
CfoI	GCGC	1 cut(s)	841
Csp6I	GTAC	1 cut(s)	557
CspCI	CAANNNNNGTGG	2 cut(s)	847, 882
CviAII	CATG	9 cut(s)	102, 154, 254, 349, 499, 599, 832, 1048, 1099
CviQI	GTAC	1 cut(s)	557
DdeI	CTNAG	2 cut(s)	479, 594
DpnI	GATC	2 cut(s)	318, 546
DpnII	GATC	2 cut(s)	316, 544
DraI	TTTAAA	2 cut(s)	654, 793
DraIII	CACNNNGTG	1 cut(s)	465
EaeI	YGGCCR	2 cut(s)	355, 1050
Eam1104I	CTCTTC	4 cut(s)	131, 228, 460, 563
EarI	CTCTTC	4 cut(s)	131, 228, 460, 563
Eco130I	CCWWGG	1 cut(s)	242
EcoRI	GAATTC	2 cut(s)	519, 909
EcoT14I	CCWWGG	1 cut(s)	242
EcoT22I	ATGCAT	1 cut(s)	940
ErhI	CCWWGG	1 cut(s)	242
FaeI	CATG	9 cut(s)	105, 157, 257, 352, 502, 602, 835, 1051, 1102
FatI	CATG	9 cut(s)	101, 153, 253, 348, 498, 598, 831, 1047, 1098
FblI	GTMKAC	1 cut(s)	873
Fnu4HI	GCNGC	3 cut(s)	635, 804, 1208
FokI	GGATG	8 cut(s)	19, 289, 365, 389, 690, 731, 1025, 1047
Fsp4HI	GCNGC	3 cut(s)	635, 804, 1208
FspBI	CTAG	2 cut(s)	243, 549
GlaI	GCGC	1 cut(s)	840
GluI	GCNGC	3 cut(s)	635, 804, 1208
HaeIII	GGCC	3 cut(s)	357, 857, 1052
HhaI	GCGC	1 cut(s)	841
Hin1I	GRCGYC	1 cut(s)	204
Hin1II	CATG	9 cut(s)	105, 157, 257, 352, 502, 602, 835, 1051, 1102
Hin6I	GCGC	1 cut(s)	839
HinP1I	GCGC	1 cut(s)	839
HincII	GTYRAC	1 cut(s)	202
HindII	GTYRAC	1 cut(s)	202
HindIII	AAGCTT	2 cut(s)	648, 972
HinfI	GANTC	5 cut(s)	336, 413, 731, 870, 1131
HphI	GGTGA	2 cut(s)	109, 290
Hpy166II	GTNNAC	4 cut(s)	202, 494, 874, 1096
Hpy188I	TCNGA	3 cut(s)	181, 567, 785
Hpy188III	TCNNGA	5 cut(s)	191, 624, 675, 832, 1184
Hpy8I	GTNNAC	4 cut(s)	202, 494, 874, 1096
Hpy99I	CGWCG	1 cut(s)	209
HpyAV	CCTTC	2 cut(s)	237, 374
HpyCH4III	ACNGT	1 cut(s)	981
HpyCH4IV	ACGT	3 cut(s)	108, 204, 1058
HpyF3I	CTNAG	2 cut(s)	479, 594
HpySE526I	ACGT	3 cut(s)	108, 204, 1058
Hsp92I	GRCGYC	1 cut(s)	204
Hsp92II	CATG	9 cut(s)	105, 157, 257, 352, 502, 602, 835, 1051, 1102
HspAI	GCGC	1 cut(s)	839
Kzo9I	GATC	2 cut(s)	316, 544
LmnI	GCTCC	1 cut(s)	244
Lsp1109I	GCAGC	2 cut(s)	646, 815
LweI	GCATC	6 cut(s)	199, 227, 574, 709, 789, 925
MaeI	CTAG	2 cut(s)	243, 549
MaeII	ACGT	3 cut(s)	108, 204, 1058
MaeIII	GTNAC	2 cut(s)	97, 1037
MalI	GATC	2 cut(s)	318, 546
MboI	GATC	2 cut(s)	316, 544
MboII	GAAGA	6 cut(s)	88, 148, 215, 447, 518, 580
MflI	RGATCY	1 cut(s)	544
MlsI	TGGCCA	2 cut(s)	357, 1052
MluNI	TGGCCA	2 cut(s)	357, 1052
MlyI	GAGTC	2 cut(s)	879, 1125
MmeI	TCCRAC	1 cut(s)	871
Mox20I	TGGCCA	2 cut(s)	357, 1052
Mph1103I	ATGCAT	1 cut(s)	940
MroXI	GAANNNNTTC	1 cut(s)	83
MscI	TGGCCA	2 cut(s)	357, 1052
MseI	TTAA	5 cut(s)	63, 408, 653, 771, 792
MslI	CAYNNNNRTG	1 cut(s)	92
Msp20I	TGGCCA	2 cut(s)	357, 1052
MspCI	CTTAAG	1 cut(s)	62
MvnI	CGCG	1 cut(s)	839
NdeII	GATC	2 cut(s)	316, 544
NlaIII	CATG	9 cut(s)	105, 157, 257, 352, 502, 602, 835, 1051, 1102
NlaIV	GGNNCC	1 cut(s)	546
NmuCI	GTSAC	2 cut(s)	97, 1037
NsiI	ATGCAT	1 cut(s)	940
PagI	TCATGA	1 cut(s)	831
PdmI	GAANNNNTTC	1 cut(s)	83
PfeI	GAWTC	3 cut(s)	336, 413, 731
PkrI	GCNGC	3 cut(s)	636, 805, 1209
Ple19I	CGATCG	1 cut(s)	319
PleI	GAGTC	2 cut(s)	878, 1125
PpsI	GAGTC	2 cut(s)	878, 1125
PsiI	TTATAA	2 cut(s)	537, 696
PspN4I	GGNNCC	1 cut(s)	546
PsuI	RGATCY	1 cut(s)	544
PvuI	CGATCG	1 cut(s)	319
RsaI	GTAC	1 cut(s)	558
RsaNI	GTAC	1 cut(s)	557
RseI	CAYNNNNRTG	1 cut(s)	92
SaqAI	TTAA	5 cut(s)	63, 408, 653, 771, 792
SatI	GCNGC	3 cut(s)	635, 804, 1208
Sau3AI	GATC	2 cut(s)	316, 544
SchI	GAGTC	2 cut(s)	879, 1125
SfaNI	GCATC	6 cut(s)	199, 227, 574, 709, 789, 925
SmiMI	CAYNNNNRTG	1 cut(s)	92
SmlI	CTYRAG	1 cut(s)	62
SmoI	CTYRAG	1 cut(s)	62
SspMI	CTAG	2 cut(s)	243, 549
StyI	CCWWGG	1 cut(s)	242
TaaI	ACNGT	1 cut(s)	981
TaiI	ACGT	3 cut(s)	111, 207, 1061
TaqI	TCGA	2 cut(s)	207, 319
TfiI	GAWTC	3 cut(s)	336, 413, 731
Tru1I	TTAA	5 cut(s)	63, 408, 653, 771, 792
Tru9I	TTAA	5 cut(s)	63, 408, 653, 771, 792
TscAI	CASTG	2 cut(s)	644, 693
TseFI	GTSAC	2 cut(s)	97, 1037
TseI	GCWGC	3 cut(s)	634, 803, 1207
Tsp45I	GTSAC	2 cut(s)	97, 1037
TspDTI	ATGAA	6 cut(s)	76, 219, 337, 515, 615, 848
TspGWI	ACGGA	1 cut(s)	891
TspRI	CASTG	2 cut(s)	644, 693
Vha464I	CTTAAG	1 cut(s)	62
XapI	RAATTY	5 cut(s)	519, 667, 797, 909, 1193
XcmI	CCANNNNNNNNNTGG	2 cut(s)	397, 466
XmaJI	CCTAGG	1 cut(s)	242
XmiI	GTMKAC	1 cut(s)	873
XmnI	GAANNNNTTC	1 cut(s)	83
XspI	CTAG	2 cut(s)	243, 549
ZraI	GACGTC	1 cut(s)	205
Zsp2I	ATGCAT	1 cut(s)	940

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.