Rroxscaffold_1G00033790

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000442
Physical Location & Seq
Forward (+)
48940250 .. 48943481
3232 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00033790.1

Sequence Viewer

Length: 267 bp
ATGGTCGCTCTGAGTTATTTTGGGGATGACTCCGACTCTCTCTCGAGAGAGAAATATCGCCAATCTCTTTCTTGGGAAAGCGGCGGCGACAAAACTACTCATCTGCGTCTCTCTTTGGGGTGCGACGGCGACAAATCTTTTTGCGATGAAGAAGATGATGGCTTGTGTGAAATGGAGTCATACTTAGCTGATAATGATCGACAGAGCGGAACGACTAGAAAAAGAAGTGATCTTCTACCTATATATGAAGAGCACGAGGTTGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.02

Weight (kDa)

4.37

Isoelectric Point (pI)

55.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000442)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g43021 FvH4_6g46860 FvH4_6g46860 FvH4_6g46860 FvH4_6g46860 FvH4_6g46882 FvH4_6g51201
rosa_chinensis RchiOBHm_Chr2g0171801 RchiOBHm_Chr6g0301581 RchiOBHm_Chr7g0179011
rosa_laevigata RLG00000005529 RLG00000009488 RLG00000017141 RLG00000019517 RLG00000022054 RLG00000022057 RLG00000022071 RLG00000022073 RLG00000022076 RLG00000022284 RLG00000023212 RLG00000023370 RLG00000024583 RLG00000027622 RLG00000033172
rosa_multiflora Rmu_sc0000888.1_g000012 Rmu_sc0002026.1_g000021
rosa_roxburghii Rroxscaffold_1G00033790 Rroxscaffold_2G00080150 Rroxscaffold_2G00080220 Rroxscaffold_2G00080240 Rroxscaffold_2G00080330 Rroxscaffold_2G00080440 Rroxscaffold_2G00080470 Rroxscaffold_4G00323360 Rroxscaffold_5G00345900
rosa_rugosa Rorug02G0085600 Rorug02G0555900 Rorug02G0556000 Rorug02G0556200 Rorug02G0556300
rosa_samantha Rh1AG323200 Rh1BG273400 Rh2AG630700 Rh2AG630900 Rh2AG631900 Rh2AG636400 Rh2BG636800 Rh2BG641800 Rh2BG641900 Rh2BG642000 Rh2BG643800 Rh2BG644200 Rh2BG644700 Rh2BG645400 Rh2BG649800 Rh2CG610100 Rh2CG610200 Rh2CG610900 Rh2CG611000 Rh2CG611100 Rh2CG611800 Rh2CG612100 Rh2CG612300 Rh2CG612400 Rh2DG357300 Rh2DG652600 Rh2DG652800 Rh2DG652900 Rh2DG653100 Rh2DG658100 Rh2DG659200 Rh2DG659300 Rh2DG659800 Rh2DG660100 Rh2DG660300 Rh2DG660400 Rh3AG273000 Rh3DG210900 Rh4AG004400 Rh4AG104800 Rh4AG105200 Rh4AG433400 Rh5AG430100 Rh5BG445500 Rh6AG494800 Rh6DG386400 Rh7AG193900 Rh7CG200400
rosa_wichuraiana Rw2G052220 Rw2G052280 Rw2G052290 Rw2G052320 Rw2G052330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 207
AciI CCGC 3 cut(s) 81, 84, 207
AluBI AGCT 1 cut(s) 188
AluI AGCT 1 cut(s) 188
Alw21I GWGCWC 1 cut(s) 255
Alw26I GTCTC 1 cut(s) 113
Ama87I CYCGRG 1 cut(s) 43
AvaI CYCGRG 1 cut(s) 43
BauI CACGAG 1 cut(s) 254
Bbv12I GWGCWC 1 cut(s) 255
BccI CCATC 1 cut(s) 152
BceAI ACGGC 1 cut(s) 142
BcoDI GTCTC 1 cut(s) 113
BfaI CTAG 1 cut(s) 216
BisI GCNGC 2 cut(s) 82, 85
BlsI GCNGC 2 cut(s) 83, 86
BmeT110I CYCGRG 1 cut(s) 43
BsaBI GATNNNNATC 1 cut(s) 195
Bse8I GATNNNNATC 1 cut(s) 195
BseGI GGATG 1 cut(s) 31
BseJI GATNNNNATC 1 cut(s) 195
BsiHKAI GWGCWC 1 cut(s) 255
BsiHKCI CYCGRG 1 cut(s) 43
BsmAI GTCTC 1 cut(s) 113
BsmBI CGTCTC 1 cut(s) 113
BsoBI CYCGRG 1 cut(s) 43
Bsp1286I GDGCHC 1 cut(s) 255
Bsp143I GATC 2 cut(s) 196, 229
BspACI CCGC 3 cut(s) 81, 84, 207
BspQI GCTCTTC 1 cut(s) 243
BsrBI CCGCTC 1 cut(s) 207
BssMI GATC 2 cut(s) 196, 229
BssSI CACGAG 1 cut(s) 254
Bst2BI CACGAG 1 cut(s) 254
Bst6I CTCTTC 1 cut(s) 243
BstDEI CTNAG 2 cut(s) 11, 184
BstF5I GGATG 1 cut(s) 31
BstKTI GATC 2 cut(s) 199, 232
BstMAI GTCTC 1 cut(s) 113
BstMBI GATC 2 cut(s) 196, 229
BtgZI GCGATG 1 cut(s) 159
BtsCI GGATG 1 cut(s) 31
CseI GACGC 1 cut(s) 95
CviJI RGCY 2 cut(s) 162, 188
CviKI_1 RGCY 2 cut(s) 162, 188
DdeI CTNAG 2 cut(s) 11, 184
DpnI GATC 2 cut(s) 198, 231
DpnII GATC 2 cut(s) 196, 229
Eam1104I CTCTTC 1 cut(s) 243
EarI CTCTTC 1 cut(s) 243
Eco88I CYCGRG 1 cut(s) 43
Esp3I CGTCTC 1 cut(s) 113
FaiI YATR 4 cut(s) 181, 242, 244, 246
Fnu4HI GCNGC 2 cut(s) 82, 85
FokI GGATG 1 cut(s) 38
Fsp4HI GCNGC 2 cut(s) 82, 85
FspBI CTAG 1 cut(s) 216
GluI GCNGC 2 cut(s) 82, 85
HgaI GACGC 1 cut(s) 95
HinfI GANTC 3 cut(s) 29, 35, 176
Hpy188I TCNGA 2 cut(s) 12, 34
Hpy188III TCNNGA 2 cut(s) 43, 45
Hpy99I CGWCG 1 cut(s) 128
HpyF3I CTNAG 2 cut(s) 11, 184
Kzo9I GATC 2 cut(s) 196, 229
LguI GCTCTTC 1 cut(s) 243
MaeI CTAG 1 cut(s) 216
MalI GATC 2 cut(s) 198, 231
MbiI CCGCTC 1 cut(s) 207
MboI GATC 2 cut(s) 196, 229
MboII GAAGA 4 cut(s) 161, 164, 224, 260
MhlI GDGCHC 1 cut(s) 255
MlyI GAGTC 3 cut(s) 23, 29, 185
MmeI TCCRAC 1 cut(s) 57
MnlI CCTC 1 cut(s) 250
NdeII GATC 2 cut(s) 196, 229
PaeR7I CTCGAG 1 cut(s) 43
PciSI GCTCTTC 1 cut(s) 243
PkrI GCNGC 2 cut(s) 83, 86
PleI GAGTC 3 cut(s) 23, 29, 184
PpsI GAGTC 3 cut(s) 23, 29, 184
SapI GCTCTTC 1 cut(s) 243
SatI GCNGC 2 cut(s) 82, 85
Sau3AI GATC 2 cut(s) 196, 229
SchI GAGTC 3 cut(s) 23, 29, 185
SduI GDGCHC 1 cut(s) 255
SetI ASST 3 cut(s) 190, 241, 261
Sfr274I CTCGAG 1 cut(s) 43
SgeI CNNG 5 cut(s) 55, 57, 84, 175, 228
SlaI CTCGAG 1 cut(s) 43
SmlI CTYRAG 1 cut(s) 43
SmoI CTYRAG 1 cut(s) 43
SsiI CCGC 3 cut(s) 81, 84, 207
SspMI CTAG 1 cut(s) 216
TaqI TCGA 2 cut(s) 44, 199
TauI GCSGC 2 cut(s) 84, 87
TspDTI ATGAA 2 cut(s) 162, 261
XhoI CTCGAG 1 cut(s) 43
XspI CTAG 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.