Rroxscaffold_5G00345900
ERF Family

S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0000442
Physical Location & Seq
Reverse (-)
16531440 .. 16532530
1091 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00345900.1

Sequence Viewer

Length: 189 bp
ATGGCGTCACAGGAAATCAGAAAAGTTTCTGAAGCATATCCAATGAAAGGTGGAGATGGCCCCGATAGCTATGCCAAGAACTCTACTTATCAGGTATTCTTTTATGGTAGTTGGGGTTGTATGTATGAAGTCTACCTAGTCCAACTTTCATATTTAGTTCACTATAAGCATTTCATGTATAGTCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Methyltransf_7

Protein Analysis

62

Amino Acids

7.28

Weight (kDa)

6.7

Isoelectric Point (pI)

49.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000442)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g43021 FvH4_6g46860 FvH4_6g46860 FvH4_6g46860 FvH4_6g46860 FvH4_6g46882 FvH4_6g51201
rosa_chinensis RchiOBHm_Chr2g0171801 RchiOBHm_Chr6g0301581 RchiOBHm_Chr7g0179011
rosa_laevigata RLG00000005529 RLG00000009488 RLG00000017141 RLG00000019517 RLG00000022054 RLG00000022057 RLG00000022071 RLG00000022073 RLG00000022076 RLG00000022284 RLG00000023212 RLG00000023370 RLG00000024583 RLG00000027622 RLG00000033172
rosa_multiflora Rmu_sc0000888.1_g000012 Rmu_sc0002026.1_g000021
rosa_roxburghii Rroxscaffold_1G00033790 Rroxscaffold_2G00080150 Rroxscaffold_2G00080220 Rroxscaffold_2G00080240 Rroxscaffold_2G00080330 Rroxscaffold_2G00080440 Rroxscaffold_2G00080470 Rroxscaffold_4G00323360 Rroxscaffold_5G00345900
rosa_rugosa Rorug02G0085600 Rorug02G0555900 Rorug02G0556000 Rorug02G0556200 Rorug02G0556300
rosa_samantha Rh1AG323200 Rh1BG273400 Rh2AG630700 Rh2AG630900 Rh2AG631900 Rh2AG636400 Rh2BG636800 Rh2BG641800 Rh2BG641900 Rh2BG642000 Rh2BG643800 Rh2BG644200 Rh2BG644700 Rh2BG645400 Rh2BG649800 Rh2CG610100 Rh2CG610200 Rh2CG610900 Rh2CG611000 Rh2CG611100 Rh2CG611800 Rh2CG612100 Rh2CG612300 Rh2CG612400 Rh2DG357300 Rh2DG652600 Rh2DG652800 Rh2DG652900 Rh2DG653100 Rh2DG658100 Rh2DG659200 Rh2DG659300 Rh2DG659800 Rh2DG660100 Rh2DG660300 Rh2DG660400 Rh3AG273000 Rh3DG210900 Rh4AG004400 Rh4AG104800 Rh4AG105200 Rh4AG433400 Rh5AG430100 Rh5BG445500 Rh6AG494800 Rh6DG386400 Rh7AG193900 Rh7CG200400
rosa_wichuraiana Rw2G052220 Rw2G052280 Rw2G052290 Rw2G052320 Rw2G052330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 132
AcuI CTGAAG 1 cut(s) 51
AcyI GRCGYC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 47
AluBI AGCT 1 cut(s) 69
AluI AGCT 1 cut(s) 69
AoxI GGCC 1 cut(s) 58
Asp700I GAANNNNTTC 1 cut(s) 25
AspS9I GGNCC 1 cut(s) 59
BccI CCATC 1 cut(s) 50
BcgI CGANNNNNNTGC 2 cut(s) 53, 87
BfaI CTAG 1 cut(s) 137
BmgT120I GGNCC 1 cut(s) 59
BmiI GGNNCC 1 cut(s) 61
BsaHI GRCGYC 1 cut(s) 5
Bsc4I CCNNNNNNNGG 1 cut(s) 47
BseLI CCNNNNNNNGG 1 cut(s) 47
BshFI GGCC 1 cut(s) 60
BslI CCNNNNNNNGG 1 cut(s) 47
BsnI GGCC 1 cut(s) 60
BspANI GGCC 1 cut(s) 60
BspLI GGNNCC 1 cut(s) 61
BssNI GRCGYC 1 cut(s) 5
BstACI GRCGYC 1 cut(s) 5
BstMWI GCNNNNNNNGC 1 cut(s) 66
BsuRI GGCC 1 cut(s) 60
Cfr13I GGNCC 1 cut(s) 59
CviAII CATG 1 cut(s) 175
CviJI RGCY 2 cut(s) 60, 69
CviKI_1 RGCY 2 cut(s) 60, 69
Eco57I CTGAAG 1 cut(s) 51
FaeI CATG 1 cut(s) 178
FaiI YATR 9 cut(s) 37, 72, 105, 122, 126, 151, 165, 176, 180
FatI CATG 1 cut(s) 174
FblI GTMKAC 1 cut(s) 132
FspBI CTAG 1 cut(s) 137
HaeIII GGCC 1 cut(s) 60
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 1 cut(s) 178
Hpy166II GTNNAC 2 cut(s) 133, 160
Hpy188I TCNGA 2 cut(s) 20, 31
Hpy8I GTNNAC 2 cut(s) 133, 160
HpyF10VI GCNNNNNNNGC 1 cut(s) 66
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 1 cut(s) 178
LpnPI CCDG 1 cut(s) 77
MaeI CTAG 1 cut(s) 137
MaeIII GTNAC 1 cut(s) 6
MmeI TCCRAC 1 cut(s) 166
MroXI GAANNNNTTC 1 cut(s) 25
MwoI GCNNNNNNNGC 1 cut(s) 66
NlaIII CATG 1 cut(s) 178
NlaIV GGNNCC 1 cut(s) 61
NmuCI GTSAC 1 cut(s) 6
PdmI GAANNNNTTC 1 cut(s) 25
PspN4I GGNNCC 1 cut(s) 61
PspPI GGNCC 1 cut(s) 59
Sau96I GGNCC 1 cut(s) 59
SetI ASST 4 cut(s) 52, 71, 96, 138
SgeI CNNG 5 cut(s) 23, 74, 88, 104, 149
SspMI CTAG 1 cut(s) 137
TseFI GTSAC 1 cut(s) 6
Tsp45I GTSAC 1 cut(s) 6
TspDTI ATGAA 4 cut(s) 59, 138, 141, 163
XmiI GTMKAC 1 cut(s) 132
XmnI GAANNNNTTC 1 cut(s) 25
XspI CTAG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.