Rh6CG272700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0000415
Physical Location & Seq
Reverse (-)
44794856 .. 44795076
221 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG272700.1

Sequence Viewer

Length: 195 bp
ATGTCTGACATTAATACCTGTGATGTTTGCAACAAGAAGTCTGTAAGTATTCACAACGCCATCACGCCGGCAACCTCCACCTCCTTATTCGCCGTCATCTCTCTCACTCCACTGTCGTTCACTCGTTCGTCGAGTGGGAGGACTGCCGGTGACTGGAGGTCAGGTGCGGAGGTTGTCGTCGTTCGCAATAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

6.77

Weight (kDa)

8.89

Isoelectric Point (pI)

51.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000415)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g17790 FvH4_2g20000 FvH4_5g06730 FvH4_5g06800 FvH4_5g06820 FvH4_6g04440 FvH4_6g04540 FvH4_6g34210
malus_domestica MD10G1023300.v1.1 MD14G1198500.v1.1
prunus_persica Prupe.2G100600_v2.0.a1 Prupe.8G205400_v2.0.a1 Prupe.8G205500_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0321451 RchiOBHm_Chr2g0160021 RchiOBHm_Chr4g0407711 RchiOBHm_Chr4g0407721 RchiOBHm_Chr4g0407751 RchiOBHm_Chr4g0407761 RchiOBHm_Chr6g0282811 RchiOBHm_Chr6g0285651 RchiOBHm_Chr6g0285661 RchiOBHm_Chr6g0285691 RchiOBHm_Chr6g0285701 RchiOBHm_Chr7g0191701
rosa_laevigata RLG00000001989 RLG00000003825 RLG00000004431 RLG00000012616 RLG00000012797 RLG00000012866 RLG00000015356 RLG00000021192 RLG00000025443
rosa_multiflora Rmu_sc0000600.1_g000050 Rmu_sc0000600.1_g000051 Rmu_sc0000600.1_g000053 Rmu_sc0000600.1_g000054 Rmu_sc0001123.1_g000019 Rmu_sc0001123.1_g000023 Rmu_sc0001521.1_g000015 Rmu_sc0002023.1_g000017
rosa_roxburghii Rroxscaffold_157G00438540 Rroxscaffold_2G00090090 Rroxscaffold_3G00263620 Rroxscaffold_7G00182850 Rroxscaffold_7G00185190 Rroxscaffold_7G00186010 Rroxscaffold_7G00215810
rosa_rugosa Rorug02G0479800 Rorug03G0030400 Rorug03G0077500 Rorug04G0221600 Rorug06G0006300 Rorug06G0157700 Rorug06G0176400 Rorug06G0511100 Rorug07G0052100 Rorug07G0220500
rosa_samantha Rh2AG546400 Rh2BG559800 Rh2CG529800 Rh2DG568400 Rh2DG568500 Rh3BG143100 Rh3DG144300 Rh4AG146200 Rh4AG146300 Rh4BG153900 Rh4CG152800 Rh6AG024300 Rh6AG262900 Rh6AG270400 Rh6AG288000 Rh6BG265800 Rh6BG272000 Rh6BG289500 Rh6CG016700 Rh6CG265100 Rh6CG272600 Rh6CG272700 Rh6CG290500 Rh6CG290700 Rh6DG017800 Rh6DG257600 Rh6DG265800 Rh6DG283200 Rh7AG119900 Rh7AG120400 Rh7BG122400 Rh7BG178300 Rh7CG125000 Rh7CG125100 Rh7DG123200 Rh7DG123500 Rh7DG123600
rosa_wichuraiana Rw4G011890 Rw4G011910 Rw4G011920

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 167
AfiI CCNNNNNNNGG 1 cut(s) 153
AhdI GACNNNNNGTC 1 cut(s) 157
AseI ATTAAT 1 cut(s) 12
AsuHPI GGTGA 1 cut(s) 161
BccI CCATC 1 cut(s) 68
BceAI ACGGC 1 cut(s) 77
BmeRI GACNNNNNGTC 1 cut(s) 157
BpmI CTGGAG 1 cut(s) 175
BsaXI ACNNNNNCTCC 2 cut(s) 148, 178
Bsc4I CCNNNNNNNGG 1 cut(s) 153
Bse118I RCCGGY 2 cut(s) 67, 146
Bse1I ACTGG 1 cut(s) 158
BseLI CCNNNNNNNGG 1 cut(s) 153
BseNI ACTGG 1 cut(s) 158
BsiSI CCGG 2 cut(s) 68, 147
BslI CCNNNNNNNGG 1 cut(s) 153
BspACI CCGC 1 cut(s) 167
BsrFI RCCGGY 2 cut(s) 67, 146
BsrI ACTGG 1 cut(s) 158
BssAI RCCGGY 2 cut(s) 67, 146
Bst4CI ACNGT 1 cut(s) 114
BstC8I GCNNGC 1 cut(s) 69
BtsIMutI CAGTG 1 cut(s) 110
Cac8I GCNNGC 1 cut(s) 69
Cfr10I RCCGGY 2 cut(s) 67, 146
DriI GACNNNNNGTC 1 cut(s) 157
Eam1105I GACNNNNNGTC 1 cut(s) 157
GsuI CTGGAG 1 cut(s) 175
HapII CCGG 2 cut(s) 68, 147
HpaII CCGG 2 cut(s) 68, 147
HphI GGTGA 1 cut(s) 161
Hpy166II GTNNAC 1 cut(s) 120
Hpy188I TCNGA 1 cut(s) 7
Hpy8I GTNNAC 1 cut(s) 120
Hpy99I CGWCG 2 cut(s) 133, 182
HpyCH4III ACNGT 1 cut(s) 114
HpyCH4V TGCA 1 cut(s) 30
KroI GCCGGC 1 cut(s) 67
KroNI GCCGGC 1 cut(s) 69
LpnPI CCDG 5 cut(s) 31, 81, 139, 147, 160
MaeIII GTNAC 1 cut(s) 149
MluCI AATT 1 cut(s) 190
MnlI CCTC 5 cut(s) 85, 91, 132, 150, 163
MroNI GCCGGC 1 cut(s) 67
MseI TTAA 1 cut(s) 12
MspI CCGG 2 cut(s) 68, 147
NaeI GCCGGC 1 cut(s) 69
NgoMIV GCCGGC 1 cut(s) 67
NmuCI GTSAC 1 cut(s) 149
PdiI GCCGGC 1 cut(s) 69
PshBI ATTAAT 1 cut(s) 12
SaqAI TTAA 1 cut(s) 12
SetI ASST 6 cut(s) 20, 77, 83, 161, 166, 174
SgeI CNNG 9 cut(s) 30, 46, 76, 80, 135, 144, 159, 166, 174
Sse9I AATT 1 cut(s) 190
SsiI CCGC 1 cut(s) 167
TaaI ACNGT 1 cut(s) 114
TaqI TCGA 1 cut(s) 131
TasI AATT 1 cut(s) 190
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TscAI CASTG 1 cut(s) 117
TseFI GTSAC 1 cut(s) 149
Tsp45I GTSAC 1 cut(s) 149
TspRI CASTG 1 cut(s) 117
VspI ATTAAT 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.