FvH4_1g29434

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Forward (+)
22516205 .. 22519845
3641 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g29434.t1

Sequence Viewer

Length: 732 bp
ATGGAAGGTGGTGATGAAAATTCAGAACAAGGGAAGAAAAGGCATAAATGGACTAGTTTTGAAGAAGAATCCTTGTTAAATGCCATTGATAATGTTCTTGCTAGTGAACAACGTTGTGACACGGGAAATTTTAAATCTGGTACGTTAGTGAGAATAGAGCATGCTTTGAATGAGTTATGTCCTAATTCCAATCTGAAGGCAAATTCTCATATTGAATCAAAGTTAAAGAAACTTAAGAAGGATTATAACATCATCTATGACATGATAAACAAGAGTGGATTTGCATGGAATGACATAAAGAAGAGTCACGTAGTGGATGTTGACACAATCGTTGACGAGATCGGTAGAATTCTGAATAACACATACTTAAATGTAGCCCTCTACCCAGTTGGAATGGATTCTCGCATTGAGAATATCAGTAATTCTTTGTCAGTTGGGTTACATGATGTTCGTATAATTGGAATTTGGGGTATGGGTGGGATAGGGAAAACAAGTATAGCAAAAACCATCTATAACAGGTTTTATCATACCTTTGAAGGTACAAGTTTCCTTGCAAATGTTAGGGAAATTGCAAAGGACTCGAATGATAAGATCACTTTGCAAGAAAGACTTCTTTCTGATATATTAAAACCAACCAAGATAGAGATAGGTACTGTTTCGAGAGGAATCAATGTGATTAAGGAAAAACTTAGAAGTAAAAAGGTACTTGTCATTGTTGATGATGTAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

244

Amino Acids

27.33

Weight (kDa)

7.74

Isoelectric Point (pI)

36.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-bind_3 PF12776 16 - 102 1.9e-06 Myb/SANT-like DNA-binding domain
NB-ARC PF00931 134 - 242 4.7e-11 NB-ARC domain
ATPase_2 PF01637 151 - 242 8.8e-06 ATPase domain predominantly from Archaea
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000261)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18411 FvH4_1g22560 FvH4_1g24290 FvH4_1g24290 FvH4_1g24290 FvH4_1g29434 FvH4_2g04031 FvH4_2g04811 FvH4_2g07610 FvH4_2g09412 FvH4_3g15552 FvH4_3g30720 FvH4_4g05810 FvH4_4g09541 FvH4_4g15171 FvH4_6g09145 FvH4_6g49541 FvH4_7g00320 FvH4_7g11552
malus_domestica MD00G1072400.v1.1 MD01G1188100.v1.1 MD07G1132000.v1.1 MD08G1190700.v1.1 MD10G1011200.v1.1 MD14G1164100.v1.1 MD15G1289200.v1.1 MD15G1289300.v1.1 MD17G1245100.v1.1
prunus_persica Prupe.6G228600_v2.0.a1
pyrus_communis pycom01g07070 pycom02g06890 pycom02g06900 pycom02g13930 pycom04g07470 pycom04g11770 pycom04g21930 pycom05g08520 pycom06g04490 pycom06g09560 pycom07g03750 pycom08g08760 pycom08g13660 pycom09g11520 pycom09g14250 pycom09g14770 pycom10g00720 pycom10g01290 pycom10g10480 pycom10g15700 pycom12420g00130 pycom12g05380 pycom12g08750 pycom13g19010 pycom13g29080 pycom14g06210 pycom14g13680 pycom14g19850 pycom15g22070 pycom15g23440 pycom15g24950 pycom15g25280 pycom16g11100 pycom16g17080 pycom16g26310 pycom17g15650 pycom17g15670 pycom17g20370
rosa_chinensis RchiOBHm_Chr1g0373591 RchiOBHm_Chr2g0105551 RchiOBHm_Chr2g0106711 RchiOBHm_Chr2g0106721 RchiOBHm_Chr7g0219611
rosa_laevigata RLG00000013773 RLG00000017436 RLG00000017533
rosa_multiflora Rmu_co8001842.1_g000001 Rmu_co8158450.1_g000001 Rmu_sc0000516.1_g000067 Rmu_sc0000566.1_g000009 Rmu_sc0000965.1_g000025 Rmu_sc0001718.1_g000001 Rmu_sc0001719.1_g000020 Rmu_sc0001822.1_g000025 Rmu_sc0002219.1_g000003 Rmu_sc0002460.1_g000059 Rmu_sc0002757.1_g000001 Rmu_sc0002860.1_g000001 Rmu_sc0004531.1_g000001 Rmu_sc0005558.1_g000003 Rmu_sc0011218.1_g000001 Rmu_sc0011998.1_g000003 Rmu_sc0015560.1_g000002 Rmu_sc0015560.1_g000003
rosa_roxburghii Rroxscaffold_1G00004200 Rroxscaffold_1G00026570 Rroxscaffold_1G00040370 Rroxscaffold_1G00044120 Rroxscaffold_1G00049590 Rroxscaffold_1G00059030 Rroxscaffold_2G00108440 Rroxscaffold_2G00108850 Rroxscaffold_2G00130680 Rroxscaffold_2G00132980 Rroxscaffold_2G00136860 Rroxscaffold_3G00218610 Rroxscaffold_4G00309940 Rroxscaffold_6G00405560
rosa_rugosa Rorug02G0138000 Rorug02G0138100 Rorug02G0138100 Rorug06G0154000
rosa_samantha Rh1AG121500 Rh1CG116300 Rh2AG189000 Rh2AG509600 Rh2BG200200 Rh2CG194100 Rh2DG195300 Rh5AG114400 Rh5DG488800
rosa_wichuraiana Rw0G022020 Rw1G023650 Rw1G026380 Rw1G034750 Rw1G040770 Rw2G014870 Rw2G016560 Rw4G031190 Rw5G026570 Rw6G003020 Rw6G012060 Rw7G014300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 246
AclI AACGTT 1 cut(s) 112
AcsI RAATTY 5 cut(s) 19, 127, 202, 348, 462
AcuI CTGAAG 1 cut(s) 215
AdeI CACNNNGTG 1 cut(s) 313
AfaI GTAC 4 cut(s) 142, 541, 652, 705
AflII CTTAAG 1 cut(s) 233
AgsI TTSAA 4 cut(s) 62, 169, 215, 536
AhlI ACTAGT 1 cut(s) 53
ApoI RAATTY 5 cut(s) 19, 127, 202, 348, 462
Asp700I GAANNNNTTC 2 cut(s) 397, 609
AsuHPI GGTGA 1 cut(s) 23
BaeI ACNNNNGTAYC 2 cut(s) 132, 165
BccI CCATC 1 cut(s) 515
BcgI CGANNNNNNTGC 2 cut(s) 561, 595
BcuI ACTAGT 1 cut(s) 53
BfaI CTAG 2 cut(s) 54, 102
BfrI CTTAAG 1 cut(s) 233
BmrI ACTGGG 1 cut(s) 380
BmuI ACTGGG 1 cut(s) 380
BsaAI YACGTR 1 cut(s) 310
Bse1I ACTGG 1 cut(s) 386
BseGI GGATG 1 cut(s) 322
BseNI ACTGG 1 cut(s) 386
Bsp143I GATC 2 cut(s) 339, 591
BspTI CTTAAG 1 cut(s) 233
BsrI ACTGG 1 cut(s) 386
BssMI GATC 2 cut(s) 339, 591
Bst4CI ACNGT 1 cut(s) 655
Bst6I CTCTTC 1 cut(s) 296
BstAFI CTTAAG 1 cut(s) 233
BstBAI YACGTR 1 cut(s) 310
BstC8I GCNNGC 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 689
BstF5I GGATG 1 cut(s) 322
BstKTI GATC 2 cut(s) 342, 594
BstMBI GATC 2 cut(s) 339, 591
BstNSI RCATGY 1 cut(s) 164
BtsCI GGATG 1 cut(s) 322
Cac8I GCNNGC 1 cut(s) 162
Csp6I GTAC 4 cut(s) 141, 540, 651, 704
CviAII CATG 4 cut(s) 161, 262, 285, 443
CviJI RGCY 1 cut(s) 377
CviKI_1 RGCY 1 cut(s) 377
CviQI GTAC 4 cut(s) 141, 540, 651, 704
DdeI CTNAG 1 cut(s) 689
DpnI GATC 2 cut(s) 341, 593
DpnII GATC 2 cut(s) 339, 591
DraI TTTAAA 1 cut(s) 133
DraIII CACNNNGTG 1 cut(s) 313
Eam1104I CTCTTC 1 cut(s) 296
EarI CTCTTC 1 cut(s) 296
Eco57I CTGAAG 1 cut(s) 215
EcoRI GAATTC 1 cut(s) 348
FaeI CATG 4 cut(s) 164, 265, 288, 446
FalI AAGNNNNNCTT 2 cut(s) 594, 626
FatI CATG 4 cut(s) 160, 261, 284, 442
FokI GGATG 1 cut(s) 329
FspBI CTAG 2 cut(s) 54, 102
Hin1II CATG 4 cut(s) 164, 265, 288, 446
HincII GTYRAC 2 cut(s) 322, 334
HindII GTYRAC 2 cut(s) 322, 334
HinfI GANTC 6 cut(s) 68, 215, 304, 398, 578, 666
HphI GGTGA 1 cut(s) 23
Hpy166II GTNNAC 3 cut(s) 107, 322, 334
Hpy188I TCNGA 4 cut(s) 25, 195, 354, 619
Hpy188III TCNNGA 1 cut(s) 660
Hpy8I GTNNAC 3 cut(s) 107, 322, 334
HpyAV CCTTC 3 cut(s) 190, 232, 530
HpyCH4III ACNGT 1 cut(s) 655
HpyCH4IV ACGT 3 cut(s) 112, 143, 309
HpyCH4V TGCA 4 cut(s) 284, 554, 572, 601
HpyF3I CTNAG 1 cut(s) 689
HpySE526I ACGT 3 cut(s) 112, 143, 309
Hsp92II CATG 4 cut(s) 164, 265, 288, 446
Kzo9I GATC 2 cut(s) 339, 591
LpnPI CCDG 3 cut(s) 123, 399, 502
MaeI CTAG 2 cut(s) 54, 102
MaeII ACGT 3 cut(s) 112, 143, 309
MaeIII GTNAC 3 cut(s) 116, 305, 438
MalI GATC 2 cut(s) 341, 593
MboI GATC 2 cut(s) 339, 591
MboII GAAGA 4 cut(s) 46, 74, 77, 313
MlyI GAGTC 2 cut(s) 313, 572
MmeI TCCRAC 1 cut(s) 370
MnlI CCTC 2 cut(s) 389, 656
MroXI GAANNNNTTC 2 cut(s) 397, 609
MseI TTAA 7 cut(s) 77, 132, 224, 234, 368, 626, 678
MspCI CTTAAG 1 cut(s) 233
NdeII GATC 2 cut(s) 339, 591
NlaIII CATG 4 cut(s) 164, 265, 288, 446
NmuCI GTSAC 2 cut(s) 116, 305
NspI RCATGY 1 cut(s) 164
PaeI GCATGC 1 cut(s) 164
PdmI GAANNNNTTC 2 cut(s) 397, 609
PfeI GAWTC 4 cut(s) 68, 215, 398, 666
PleI GAGTC 2 cut(s) 312, 572
PpsI GAGTC 2 cut(s) 312, 572
Ppu21I YACGTR 1 cut(s) 310
PsiI TTATAA 1 cut(s) 246
Psp1406I AACGTT 1 cut(s) 112
RsaI GTAC 4 cut(s) 142, 541, 652, 705
RsaNI GTAC 4 cut(s) 141, 540, 651, 704
SaqAI TTAA 7 cut(s) 77, 132, 224, 234, 368, 626, 678
Sau3AI GATC 2 cut(s) 339, 591
SchI GAGTC 2 cut(s) 313, 572
SetI ASST 9 cut(s) 10, 115, 146, 312, 521, 533, 541, 652, 705
SmlI CTYRAG 1 cut(s) 233
SmoI CTYRAG 1 cut(s) 233
SpeI ACTAGT 1 cut(s) 53
SphI GCATGC 1 cut(s) 164
SspMI CTAG 2 cut(s) 54, 102
TaaI ACNGT 1 cut(s) 655
TaiI ACGT 3 cut(s) 115, 146, 312
TaqI TCGA 2 cut(s) 581, 659
TfiI GAWTC 4 cut(s) 68, 215, 398, 666
Tru1I TTAA 7 cut(s) 77, 132, 224, 234, 368, 626, 678
Tru9I TTAA 7 cut(s) 77, 132, 224, 234, 368, 626, 678
TseFI GTSAC 2 cut(s) 116, 305
Tsp45I GTSAC 2 cut(s) 116, 305
TspDTI ATGAA 1 cut(s) 30
Vha464I CTTAAG 1 cut(s) 233
XapI RAATTY 5 cut(s) 19, 127, 202, 348, 462
XceI RCATGY 1 cut(s) 164
XmnI GAANNNNTTC 2 cut(s) 397, 609
XspI CTAG 2 cut(s) 54, 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.